View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2786-Insertion-12 (Length: 152)
Name: NF2786-Insertion-12
Description: NF2786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2786-Insertion-12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 6e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 6e-54
Query Start/End: Original strand, 8 - 143
Target Start/End: Original strand, 51745422 - 51745557
Alignment:
| Q |
8 |
ttctacacagtaagtttacatctacattcccacaatttcatatcttattttcaatttttgaannnnnnnatgttatatttactacatgaaattaaagttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
51745422 |
ttctacacagtaagtttacatctacattcccacaatttcatatcttattttcaatttttgaatttttttatgttatatttactgcatgaaattaaagttt |
51745521 |
T |
|
| Q |
108 |
ggatttttatcgttttgaagatcgttaaaggcaaca |
143 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51745522 |
ggatttttattgttttgaagatcgttaaaggcaaca |
51745557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University