View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2786-Insertion-15 (Length: 96)

Name: NF2786-Insertion-15
Description: NF2786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2786-Insertion-15
NF2786-Insertion-15
[»] chr1 (1 HSPs)
chr1 (7-96)||(6635083-6635172)
[»] chr3 (1 HSPs)
chr3 (26-96)||(52163978-52164048)
[»] chr5 (2 HSPs)
chr5 (11-96)||(15964316-15964401)
chr5 (8-96)||(7266387-7266475)
[»] chr6 (1 HSPs)
chr6 (65-96)||(2498577-2498608)
[»] chr4 (1 HSPs)
chr4 (65-96)||(27101165-27101196)


Alignment Details
Target: chr1 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 6635172 - 6635083
Alignment:
Q  7 acttggttcactgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtga 96  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6635172 acttggttcattgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtga 6635083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 26 - 96
Target Start/End: Complemental strand, 52164048 - 52163978
Alignment:
Q  26 tttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtga 96  Q
    ||||||||||||||||| ||| | |||| ||| ||||||||||| |||||||||||||| |||||||||||    
T  52164048 tttttgcttgtttttgccgggaatattgctccggtggatcataggtggaatcaacatggacttggtggtga 52163978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 15964401 - 15964316
Alignment:
Q  11 ggttcactgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtga 96  Q
    |||||| ||||||||||||| ||||||||||||||  |  |||   |  | ||||||||||||||||||||||| |||||||||||    
T  15964401 ggttcattgccaccttttttacttgtttttgcaggaaatgttgaagctattgatcatagatggaatcaacatggacttggtggtga 15964316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 7266475 - 7266387
Alignment:
Q  8 cttggttcactgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtga 96  Q
    ||||||||| |||| || ||| |||||||||| |||||  |||| ||||| || |||||| | |||||||||||||| ||||| |||||    
T  7266475 cttggttcattgccgccgtttctgcttgttttcgcaggtaaaatagttccggttgatcatcggtggaatcaacatgggcttggcggtga 7266387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 65 - 96
Target Start/End: Complemental strand, 2498608 - 2498577
Alignment:
Q  65 catagatggaatcaacatggtcttggtggtga 96  Q
    ||||||||||||||||||||||||||||||||    
T  2498608 catagatggaatcaacatggtcttggtggtga 2498577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 65 - 96
Target Start/End: Complemental strand, 27101196 - 27101165
Alignment:
Q  65 catagatggaatcaacatggtcttggtggtga 96  Q
    ||||||||||||||||||||||||||||||||    
T  27101196 catagatggaatcaacatggtcttggtggtga 27101165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University