View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2786-Insertion-17 (Length: 69)
Name: NF2786-Insertion-17
Description: NF2786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2786-Insertion-17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 13942720 - 13942669
Alignment:
| Q |
8 |
gatattccaatgggtgtcaaacataagttccaacattgttgagcttgacctt |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
13942720 |
gatattccaatgggtgtcaaacataagttctaatcttgttgagcttgacctt |
13942669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 14086170 - 14086109
Alignment:
| Q |
8 |
gatattccaatgggtgtcaaacataagttccaacattgttgagcttgacctttcttttaacc |
69 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||| |||||||| |||| ||||||| |
|
|
| T |
14086170 |
gatattccaattggtgtcaaacataagttccaatcttgttaagcttgacatttcatttaacc |
14086109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 13861403 - 13861450
Alignment:
| Q |
22 |
tgtcaaacataagttccaacattgttgagcttgacctttcttttaacc |
69 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
13861403 |
tgtcaaacataagttccaatcttgttgagcttgacctttctttcaacc |
13861450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 14026697 - 14026643
Alignment:
| Q |
8 |
gatattccaatgggtgtcaaacataagttccaacattgttgagcttgacctttct |
62 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14026697 |
gatattccattgggtgtcaaacataagttccaatcttgtaaagcttgacctttct |
14026643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 13942553 - 13942513
Alignment:
| Q |
22 |
tgtcaaacataagttccaacattgttgagcttgacctttct |
62 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13942553 |
tgtcaaacataagttccaatcttgttgagcttgacctttct |
13942513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 13471418 - 13471457
Alignment:
| Q |
20 |
ggtgtcaaacataagttccaacattgttgagcttgacctt |
59 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13471418 |
ggtgtcaaacataagttccaatcttgttgagcttgacctt |
13471457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 14016736 - 14016685
Alignment:
| Q |
8 |
gatattccaatgggtgtcaaacataagttccaacattgttgagcttgacctt |
59 |
Q |
| |
|
||||||||| |||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
14016736 |
gatattccattgggtgtcaaacataagtgctaatcttgttgagcttgacctt |
14016685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 14086323 - 14086272
Alignment:
| Q |
8 |
gatattccaatgggtgtcaaacataagttccaacattgttgagcttgacctt |
59 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14086323 |
gatattccagtgggtgtcaaacataagttccaatcttgttttgcttgacctt |
14086272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 14016583 - 14016529
Alignment:
| Q |
8 |
gatattccaatgggtgtcaaacataagttccaacattgttgagcttgacctttct |
62 |
Q |
| |
|
|||||| || |||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
14016583 |
gatatttcagtgggtgtcaaacatgagttccaatcttattgagcttgacctttct |
14016529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 13873864 - 13873915
Alignment:
| Q |
10 |
tattccaatgggtgtcaaacataagttccaacattgttgagcttgacctttc |
61 |
Q |
| |
|
||||||| ||| | ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
13873864 |
tattccagtggctttcaaacataagttccaatcttgttaagcttgacctttc |
13873915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University