View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2786R-Insertion-2 (Length: 160)
Name: NF2786R-Insertion-2
Description: NF2786R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2786R-Insertion-2 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 6e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 6e-23
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 3677177 - 3677235
Alignment:
| Q |
102 |
caaatcgtggcatgatgactgcaaattgtgaggctgttttacaattgtcttgcaacggg |
160 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3677177 |
caaatcgtggcatgatgactgcaaatcgtgaggctgttttacaattgtcttgcaacggg |
3677235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 3677081 - 3677127
Alignment:
| Q |
9 |
gctcgagtgtatgagagagaagaatttaagacttaaagaactctaat |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3677081 |
gctcgagtgtatgagagagaagaatttaagacttaaagaactctaat |
3677127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University