View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2787_high_31 (Length: 201)
Name: NF2787_high_31
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2787_high_31 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 64 - 201
Target Start/End: Complemental strand, 3255747 - 3255616
Alignment:
| Q |
64 |
ttaccaagcaacactagccatccattaatataacgtcgcgtgtcaaggaacaactggcccaatctaagttgcaccaaccgttgaactgcaagtcacatgc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| | | | ||||||||||||||||||||||||| |||| |
|
|
| T |
3255747 |
ttaccaagcaacactagccatccattaatataacgtcg--tgtcaagggacaactggcccagtttgaattgcaccaaccgttgaactgcaagttacat-- |
3255652 |
T |
 |
| Q |
164 |
gcgcactacccaaaaatattcgttgtcctggattacct |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3255651 |
--gcactacccaaatatattcgttgtcctggattacct |
3255616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 3255782 - 3255746
Alignment:
| Q |
9 |
agcataggaccgagagaggatatgttgtttctttgtt |
45 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
3255782 |
agcagaggatcgagagaggatatgttgtttctttgtt |
3255746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 9 - 201
Target Start/End: Complemental strand, 33159806 - 33159620
Alignment:
| Q |
9 |
agcataggaccgagagaggatatgttgtttctttgtttttcaagaaatatgagatttaccaagcaacactagccatccattaatataacgtcgcgtgtca |
108 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| | | | | |||||| |||| |
|
|
| T |
33159806 |
agcagaggaccgagagacagtatgttgtttctttgttttccaagaaataggagatttaccaagcaacactagccaaccagtgacagagcgtcgc--gtca |
33159709 |
T |
 |
| Q |
109 |
aggaacaactggcccaatctaagttgcaccaaccgttgaactgcaagtcacatgcgcgcactacccaaaaatattcgttgtcctggattacct |
201 |
Q |
| |
|
||| |||||||||||| ||| ||| |||||||||| || ||| ||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
33159708 |
agggacaactggcccagtctgagtcacaccaaccgtggagctgtaagtcacat----gcactacccaaaaatattccttgtcccggattacct |
33159620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University