View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2787_high_6 (Length: 368)
Name: NF2787_high_6
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2787_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 9298843 - 9298651
Alignment:
| Q |
19 |
agctttattttttgaggggaatgttgtctggctcgaggacgctttcttctcgatctaatgcaaatttgtggtcatggattgtaaagtattctcggaccag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298843 |
agctttattttttgaggggaatgttgtctggctcgaggacgctttcttctcgatctaatgcaaatttgtggtcatggattgtaaagtattctcggaccag |
9298744 |
T |
|
| Q |
119 |
gcttcattccccccaattatatgcttccatggactatacatacactttcataggtttgatttcatttcatttctctctctaaaattatatata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298743 |
gcttcattccccccaattatatgcttccatggactatacatacactttcataggtttgatttcatttcatttctctctctaaaattatatata |
9298651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 251 - 348
Target Start/End: Complemental strand, 9298611 - 9298513
Alignment:
| Q |
251 |
cctaaatataggtagatctgaatcatgggtttttgatttttggttgaattt-agatttatgtaatttgcagattggtgtaatgatgaagtattttgaca |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9298611 |
cctaaatataggtagatctgaatcatgggtttttgatttttggttgagtttaagatttatgtaatttgcagattggtgtaatgatgaaacattttgaca |
9298513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University