View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2787_low_13 (Length: 339)
Name: NF2787_low_13
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2787_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 17 - 331
Target Start/End: Original strand, 6587805 - 6588120
Alignment:
| Q |
17 |
ccttcatctcaatggctcactcaagaaaatgcttagagaagctggtgcactttggctttaggaaaacttgaaatatggaagctcgcattctagtgcaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587805 |
ccttcatctcaatggctcactcaagaaaatgcttagagaagctggtgcactttggctttaggaaaacttgaaatatggaagctcgcattctagtgcaaat |
6587904 |
T |
 |
| Q |
117 |
gcaaacagccaaaaattgccttttttatataatatcctaaccaagccctc--nnnnnnnnngtgagaccttgcggctttaagaatatgcattgtattaga |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587905 |
gcaaacagccaaaaatggccttttttatataatatcctaaccaagccctctttttttttttgtgagaccttgcggctttaagaatatgcattgtattaga |
6588004 |
T |
 |
| Q |
215 |
ataatctttgttacctccaatataattttgagttgtacttctgaaactctgtgtacattgtttctcctttttcttttcttcacgaattgagtatttgcaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6588005 |
ataatctttgttacctccaatataattttgagttgtacttctgaaactttgtgtgcattgtttctccttttt-ttttcttcacgaattgagtatttgcaa |
6588103 |
T |
 |
| Q |
315 |
ctatataaattcatctc |
331 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6588104 |
ctatataaattcatctc |
6588120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University