View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2787_low_17 (Length: 297)
Name: NF2787_low_17
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2787_low_17 |
 |  |
|
| [»] scaffold0354 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0354 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 13192 - 13471
Alignment:
| Q |
18 |
tcacctggccatgccttcaatctccaccaaattcaccatccaaatattcaccccaaccaaagaacactcaaaccaagcaacaaaaaaccttcatgcaggc |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
13192 |
tcacctggcgatgccttcaatctccaccaaattcaccatccaaatcttcaccccaaccagagaacactcaaaccaagcaaaaaaaaaccttcgcgcaggc |
13291 |
T |
 |
| Q |
118 |
cgtgagtaatatatgtgacattccattgagtcagttgcctaaaccatgtcttaaaggtgatgatagagctattcaaattcctgatgatgaatatgaggct |
217 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13292 |
catgagtaatatatgtgacattccattaagtcagtggcctaaaccatgtcttaaaggtgatgatagagctattcagattcctgatgatgaatatgaggct |
13391 |
T |
 |
| Q |
218 |
ggtttagagacatgcaagtataatctacaagggaagattatttggccaaagggttcaaaccatattactgttgattcctt |
297 |
Q |
| |
|
||||||||||||||| || ||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13392 |
ggtttagagacatgcgagcataatctgcaaggcaagattatttggccaaagggttcaaaccctattactgttgattcctt |
13471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 235
Target Start/End: Complemental strand, 14672712 - 14672641
Alignment:
| Q |
164 |
tgtcttaaaggtgatgatagagctattcaaattcctgatgatgaatatgaggctggtttagagacatgcaag |
235 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||| |||||||||||| ||| ||| || |||||| |||||||| |
|
|
| T |
14672712 |
tgtcttaagggtgatgatagggttattcaaatccctgatgatgaaaatggggcaggattagaggcatgcaag |
14672641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University