View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2787_low_18 (Length: 294)

Name: NF2787_low_18
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2787_low_18
NF2787_low_18
[»] chr4 (2 HSPs)
chr4 (62-156)||(2155093-2155189)
chr4 (18-53)||(2155036-2155071)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 62 - 156
Target Start/End: Original strand, 2155093 - 2155189
Alignment:
62 ctagacatgtccacacactatgtcatttata--tgccccgtttgttattcattcagcactaaaagtagataaacaaatatgggtatgtttaatcagg 156  Q
    |||||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2155093 ctagacatgtccacacactatgtcatttatatatgccccgtttattattcattcagcactaaaagtagataaacaaatatgggtatgtttaatcagg 2155189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 2155036 - 2155071
Alignment:
18 atgtatttaaatgttaatattgcccatagttatgat 53  Q
    ||||||||||||||||||||||||||||||||||||    
2155036 atgtatttaaatgttaatattgcccatagttatgat 2155071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University