View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2787_low_28 (Length: 251)
Name: NF2787_low_28
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2787_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 39446116 - 39446352
Alignment:
| Q |
1 |
aaatagaacttgacattggaaataaatctaacaaacatttgctaaggagagattttttattattannnnnnnnnnnngtatttaccctctagtttcaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || | ||||||||||||| ||||||||| |
|
|
| T |
39446116 |
aaatagaacttgacattggaaataaatctaacaaacatttgttaaggagagattttttttttct---------ttttgtatttaccctctggtttcaacg |
39446206 |
T |
 |
| Q |
101 |
agaagggctctcgtaatcctgaattcggttgggagataagtaaaatttgaccaaaaaatatttcacttaagaattgaacccaagttctcctaaaaaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||| |||| |||| |||||||| ||||| ||| |||| ||||||||||||||| |
|
|
| T |
39446207 |
agaagggctctcgtaatcctgaattcggttgggagagaaataaaatttggccaacaaatgtttcactttagaatcgaatccaaattctcctaaaaaattt |
39446306 |
T |
 |
| Q |
201 |
gttattggtggagttcatcaacaattgagctcaaatgtttggttat |
246 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39446307 |
gttatcggtggagttcatcaacaattgaggtcaaatgtttggttat |
39446352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 187 - 246
Target Start/End: Original strand, 39467630 - 39467689
Alignment:
| Q |
187 |
ctcctaaaaaattcgttattggtggagttcatcaacaattgagctcaaatgtttggttat |
246 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
39467630 |
ctcctaaaaaaatcgtccttggtggagttcatcaacaattaatctcaaatgtttggttat |
39467689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University