View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2787_low_33 (Length: 211)
Name: NF2787_low_33
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2787_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 44729790 - 44729612
Alignment:
| Q |
1 |
agggtggaagcctagcttggataccattaaggaaaagaaggttaagagaaagatatctggttggttattccttacaagttttattggtgcaaagatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729790 |
agggtggaagcctagcttggatacaattaaggaaaagaaggttaagagaaagatatctggttggttattccttacaagttttattggtgcaaagatttga |
44729691 |
T |
 |
| Q |
101 |
tcaataatatggtcaaattagtgaaagttgttggtttaagttggttttaattgttagttatgttatattggcacttctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729690 |
tcaataatatggtcaaattagtgaaagttgttggtttaagttggttttaattgttagttatgttatattggcacttctg |
44729612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 39084276 - 39084314
Alignment:
| Q |
1 |
agggtggaagcctagcttggataccattaaggaaaagaa |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
39084276 |
agggtggaagcctagcttggatactattaaggagaagaa |
39084314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University