View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2787_low_34 (Length: 211)

Name: NF2787_low_34
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2787_low_34
NF2787_low_34
[»] chr2 (1 HSPs)
chr2 (10-195)||(337454-337633)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 337633 - 337454
Alignment:
10 gagatgaaccaacatcatcatcatcatcgtaaaatccaacgttatttggtggcggttgagtacattggaactcgcttctttggttttcagaagcagctca 109  Q
    |||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
337633 gagatgaaccaacatcatcatcatc---gtaaaatccaacgttatttggtggcggttgagtacattggaactcgcttctttggttttcagaagcagctca 337537  T
110 ctgaccgtactgttgctggtgttcttgaggttagtaacaacatatcccaatcccatgtaatgtttttgtgattgtttatgttattt 195  Q
    |||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||    
337536 ctgaccgtactgttgctggtgttcttgaggttagt---aacatatcccaatcccatgtaatgtttttgtgattgtttatgttattt 337454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University