View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2787_low_7 (Length: 410)

Name: NF2787_low_7
Description: NF2787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2787_low_7
NF2787_low_7
[»] chr4 (1 HSPs)
chr4 (9-199)||(49732579-49732765)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 49732579 - 49732765
Alignment:
9 gaaatgaaaggatgtgtcgttgtatagtcttttgcggcgttgtttaatagggtgacctgacacaaacaagcaatgaccctgaaaatcagattaggttcgg 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||    
49732579 gaaatgaaaggatgtgtcgttgtatagtcttttgcggcgttgtttaatagggtgacctgacacaa----gcaatgaccctgaaaatcagattaggttcgg 49732674  T
109 ggatgtgtatttatttgtttcttctcacttggctggttgcttattactcaagtcaaaattaaggttattcaaagatgaaccatgtctttat 199  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49732675 ggacgtgtatttatttgtttcttctcacttggctggttgcttattactcaagtcaaaattaaggttattcaaagatgaaccatgtctttat 49732765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University