View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2789_high_6 (Length: 250)
Name: NF2789_high_6
Description: NF2789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2789_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 30079435 - 30079192
Alignment:
| Q |
8 |
cagcacagaaaacactctcatgatctaggattttgccatgtgaaattttgataaagagagaatcatagtatgaacaaatctccaccttctgtctcaatct |
107 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079435 |
cagcacagaacacattttcatgatctaggattttgccatgtgaaattttgataaagagagaatcatagtatgaacaaatctccaccttctgtctcaatct |
30079336 |
T |
 |
| Q |
108 |
tctctctaccttgtccttctgtct--aactcaaagtctttgttgtttagtccatttctttattcataactgtattagtactaattataaagttggtacga |
205 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079335 |
-ctctctaccttgtccctctgtctttaactcaaagtctttgttgtttagtccatttctttattcataactgtattagtactaattataaagttggtacga |
30079237 |
T |
 |
| Q |
206 |
aacatagcaatttgagtatagtgtataccataaagtttctattgc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079236 |
aacatagcaatttgagtatagtgtataccataaagtttctattgc |
30079192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University