View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2789_low_9 (Length: 208)
Name: NF2789_low_9
Description: NF2789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2789_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 31028305 - 31028109
Alignment:
| Q |
15 |
tgagaagatggtgagagtggtactgttgagttcatacatagtgatgccattgtattgattttatgatgatatgatattgttatgttcccatttactctca |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028305 |
tgagaagatggtgagagtggtactgtggagttcatacatagtgatgccattgtattgattttatgatgatatgatattgttatgttcccatttactctca |
31028206 |
T |
|
| Q |
115 |
aagaataagaaaattacga----------gaaatagttttgctattatacggaaaagctcctcaaccaagcatttgattataggattattgatgatg |
201 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028205 |
aagaataacaaaattacgagaaaacgagagaaatagttttgctattatacgaaaaagctcctcaaccaagcatttgattataggattattgatgatg |
31028109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University