View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2790_low_14 (Length: 237)
Name: NF2790_low_14
Description: NF2790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2790_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 31636401 - 31636624
Alignment:
| Q |
1 |
tcgttgcagtctgtgtaatcatcgcacatacacgttggaatattgatgatgaagatcattaaaagtatcacggagaaaaagagaaaagaagatggatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31636401 |
tcgttgcagtctgtgtaatcattgcacatacacgttggaatattgatgatgaagatcatcaaaagcatcacggagaaaaagagaaaagaagatggatgaa |
31636500 |
T |
|
| Q |
101 |
gaagaggtttcattcttgcagccgaagaaagaaagttagaataggtttagttggaaagaggaatagcactaaaagggatataaatcaatgtctgaaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31636501 |
gaagaggtttcattcttgcagccgaagaaagaaagttagaataggtttagttggaaagaggaatagcactaaaagggatataaatcaatgtctgaaataa |
31636600 |
T |
|
| Q |
201 |
ac-aaactacgcgtagttgattat |
223 |
Q |
| |
|
|| ||||||||||||||| ||||| |
|
|
| T |
31636601 |
acaaaactacgcgtagtttattat |
31636624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 31621406 - 31621469
Alignment:
| Q |
1 |
tcgttgcagtctgtgtaatcatcgcacatacacgttggaatattgatgatgaagatcattaaaa |
64 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31621406 |
tcgttgcagtctgtgtaatcattgcacatacacgttggaatattgatgatgaagatcatcaaaa |
31621469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 31616686 - 31616718
Alignment:
| Q |
18 |
atcatcgcacatacacgttggaatattgatgat |
50 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
31616686 |
atcatcacacatacacgttggaatattgatgat |
31616718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University