View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2791_high_6 (Length: 245)

Name: NF2791_high_6
Description: NF2791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2791_high_6
NF2791_high_6
[»] chr7 (1 HSPs)
chr7 (4-241)||(7750217-7750454)


Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 7750217 - 7750454
Alignment:
4 cacagaggcatttattatgataaaaaacatgtgaatcaaaattgaaccaccttttgggaattgggccacaaagcctattgaaactaacatcaaggtttgt 103  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7750217 cacaaaggcatttattatgataaaaaacatgtgaatcaaaattgaaccaccttttgggaattgggccacaaagcctattgaaactaacatcaaggtttgt 7750316  T
104 taggctcttggggaatttgggtattgaaccagtgagcttgttatgggagacatcaagaagagacagagccggcaggtttccgagagaggcctgaattggg 203  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
7750317 taggctcttggggaattcgggtattgaaccagtgagcttgttatgggagacatcaagaagagacagagccggcaggtttccgagagaggccggaattggg 7750416  T
204 ccagaaaaacggttatttgctaggacgattaaggtgag 241  Q
    ||||||||||||||||||||||||||||||||||||||    
7750417 ccagaaaaacggttatttgctaggacgattaaggtgag 7750454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University