View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2791_high_6 (Length: 245)
Name: NF2791_high_6
Description: NF2791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2791_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 7750217 - 7750454
Alignment:
| Q |
4 |
cacagaggcatttattatgataaaaaacatgtgaatcaaaattgaaccaccttttgggaattgggccacaaagcctattgaaactaacatcaaggtttgt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750217 |
cacaaaggcatttattatgataaaaaacatgtgaatcaaaattgaaccaccttttgggaattgggccacaaagcctattgaaactaacatcaaggtttgt |
7750316 |
T |
 |
| Q |
104 |
taggctcttggggaatttgggtattgaaccagtgagcttgttatgggagacatcaagaagagacagagccggcaggtttccgagagaggcctgaattggg |
203 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7750317 |
taggctcttggggaattcgggtattgaaccagtgagcttgttatgggagacatcaagaagagacagagccggcaggtttccgagagaggccggaattggg |
7750416 |
T |
 |
| Q |
204 |
ccagaaaaacggttatttgctaggacgattaaggtgag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750417 |
ccagaaaaacggttatttgctaggacgattaaggtgag |
7750454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University