View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2792-Insertion-19 (Length: 104)
Name: NF2792-Insertion-19
Description: NF2792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2792-Insertion-19 |
 | |
|
| [»] chr5 (5 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 7e-40; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 6 - 104
Target Start/End: Complemental strand, 15546893 - 15546795
Alignment:
| Q |
6 |
cacttatttgctccatcaaactcctcaacttttgttactctcacttgtcttccattcccagccttccatccaaacctttcttgttcccatttcattgcc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15546893 |
cacttatttgctccatcaaactcctcaacttttgttactctcacttgtctttcattcccagcattccatccaaaccttctttgttcccatttcattgcc |
15546795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 15551690 - 15551601
Alignment:
| Q |
12 |
tttgctccatcaaactcctcaacttttgttactctcacttgtcttccattcccagccttccatccaaacctttcttgttcccatttcatt |
101 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15551690 |
tttgttccatcaaactcttcaacttttgttactctcacttgtcttccattcccagcattccatccaaacctttcttgttcccatttcatt |
15551601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 15519640 - 15519548
Alignment:
| Q |
12 |
tttgctccatcaaactcctcaacttttgttactctcacttgtcttccattcccagccttccatccaaacctttcttgttcccatttcattgcc |
104 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15519640 |
tttgttccatcaaactcttcaacttttgttactctcacttgtcttccattcccagcattccatccaaaccttctttgttcccatttcattgcc |
15519548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 15523298 - 15523206
Alignment:
| Q |
12 |
tttgctccatcaaactcctcaacttttgttactctcacttgtcttccattcccagccttccatccaaacctttcttgttcccatttcattgcc |
104 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15523298 |
tttgttccatcaaactcttcaacttttgttactctcacttgtcttccattcccagcattccatccaaaccttctttgttcccatttcattgcc |
15523206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 15529379 - 15529290
Alignment:
| Q |
12 |
tttgctccatcaaactcctcaacttttgttactctcacttgtcttccattcccagccttccatccaaacctttcttgttcccatttcatt |
101 |
Q |
| |
|
|||| |||| ||||||| |||| ||||||||| | ||||||||||| ||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
15529379 |
tttgttccaccaaactcttcaaattttgttaccttgacttgtcttcctttccctgcattccatccaaacctttcttgttcccatttcatt |
15529290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University