View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2792-Insertion-21 (Length: 58)
Name: NF2792-Insertion-21
Description: NF2792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2792-Insertion-21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 6992124 - 6992176
Alignment:
| Q |
6 |
caattctaccatgtaagattctctcttaaataagcttaaatctacccttttga |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6992124 |
caattctaccatgtaagattctctcttaaataagcttaaatctacccttttga |
6992176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University