View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2793_high_13 (Length: 309)
Name: NF2793_high_13
Description: NF2793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2793_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 282
Target Start/End: Complemental strand, 23332866 - 23332595
Alignment:
| Q |
11 |
cagagacatgttcgaggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggt |
110 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332866 |
cagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggt |
23332767 |
T |
|
| Q |
111 |
gcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctc |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332766 |
gcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctc |
23332667 |
T |
|
| Q |
211 |
ccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacatat |
282 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332666 |
ccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University