View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_high_14 (Length: 255)
Name: NF2794_high_14
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_high_14 |
 |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 71)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 247
Target Start/End: Original strand, 42805554 - 42805797
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805554 |
cctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggt |
42805653 |
T |
 |
| Q |
104 |
tgccctttttagtgaaaattataaaaataatatttctaactgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805654 |
tgccctttttagtgaaaattataaaaataatatttctaagtgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaa |
42805753 |
T |
 |
| Q |
204 |
gcactccataccttgaaccgcacactgtttcaaatgtctgtgct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42805754 |
gcactccataccttgaaccgcacactgtttcaaatgtctttgct |
42805797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 47716489 - 47716596
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47716489 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggt |
47716588 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
47716589 |
tgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 112 - 247
Target Start/End: Original strand, 42763053 - 42763191
Alignment:
| Q |
112 |
ttagtgaaaattataaaaataatatttctaac---tgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaagcact |
208 |
Q |
| |
|
||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| || |
|
|
| T |
42763053 |
ttagtaaaaattataaaattaatatttctaaaaagtgaagttcaaaataagtaactcaagaccagttttttacatctagctcttgcatatcttaagcgct |
42763152 |
T |
 |
| Q |
209 |
ccataccttgaaccgcacactgtttcaaatgtctgtgct |
247 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||| |
|
|
| T |
42763153 |
ccataccttgaactgcacacagtttcaaatgtctttgct |
42763191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 43557502 - 43557612
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccggg |
102 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||| ||| | || ||||||||||| |||||||||||||| |
|
|
| T |
43557502 |
cctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccggg |
43557601 |
T |
 |
| Q |
103 |
ttgcccttttt |
113 |
Q |
| |
|
||||||||||| |
|
|
| T |
43557602 |
ttgcccttttt |
43557612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 7879669 - 7879775
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
7879669 |
ctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggtt |
7879766 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
7879767 |
gcccttttt |
7879775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 46354221 - 46354302
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46354221 |
caacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 21172112 - 21172008
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
21172112 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
21172017 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
21172016 |
tgccctttt |
21172008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 16 - 113
Target Start/End: Complemental strand, 42391193 - 42391098
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42391193 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
42391098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 5 - 114
Target Start/End: Original strand, 42798700 - 42798807
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||| ||||| ||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
42798700 |
ctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaa--atggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggtt |
42798797 |
T |
 |
| Q |
105 |
gcccttttta |
114 |
Q |
| |
|
|||||||||| |
|
|
| T |
42798798 |
gcccttttta |
42798807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 2541124 - 2541019
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||| | ||| || |||||||||||||||||||||||||| |
|
|
| T |
2541124 |
cctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaa--atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggt |
2541027 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
2541026 |
ttcccttt |
2541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 48735228 - 48735122
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
48735228 |
caacctcttgtgtaaaacac--ggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
48735133 |
T |
 |
| Q |
101 |
ggttgcccttt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
48735132 |
ggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 32758291 - 32758396
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
32758291 |
cctcttgtgtaaaa--cagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
32758386 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
32758387 |
tgcccttttt |
32758396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 11617696 - 11617589
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||| || ||||| ||| ||||||||||||| |
|
|
| T |
11617696 |
caacctcttgtgtaaaaaacagggtaagactgcgtacaatacacca--aatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccg |
11617599 |
T |
 |
| Q |
101 |
ggttgccctt |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
11617598 |
ggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 27629664 - 27629771
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||| |||||||||||||||||| | ||| |||||||||| ||||| |||||||||||| |
|
|
| T |
27629664 |
cctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaa--atggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggt |
27629761 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
27629762 |
tgcccttttt |
27629771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 10693176 - 10693073
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
10693176 |
cctcttgtgtaaaaga--gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggt |
10693081 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
10693080 |
tgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 5 - 111
Target Start/End: Complemental strand, 22699074 - 22698967
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccc-cttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||| ||||| ||||| | |||||||||||| ||||||||||||| |
|
|
| T |
22699074 |
ctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggt |
22698975 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
22698974 |
tacccttt |
22698967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 29907449 - 29907552
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| || |||||||||| | ||||||||||| |||||||||||||| |||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
29907449 |
cctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa-aatggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggt |
29907545 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
29907546 |
tgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 33872017 - 33871914
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
33872017 |
caacctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcacca |
33871921 |
T |
 |
| Q |
101 |
ggttgcc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
33871920 |
ggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 16341308 - 16341413
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| ||||||||| || |||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
16341308 |
cctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaa-aatggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggc |
16341406 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
16341407 |
tgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 19426994 - 19426888
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||||||| |||||||||||| ||| | ||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
19426994 |
cctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaa--atggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggt |
19426898 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
19426897 |
tgcccttttt |
19426888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 21566465 - 21566562
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||||||||||||||| | ||| |||| ||||||||||||| |||||| |||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
21566465 |
cctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaa-aatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 31591215 - 31591108
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||| || |||||||||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
31591215 |
caacctcttgtgtaaaa--cagagtaaggctgcgtacaatacaataa--atggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccg |
31591120 |
T |
 |
| Q |
101 |
ggttgccctttt |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31591119 |
ggttgccctttt |
31591108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 23419779 - 23419674
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||| ||||| || | |||||| ||||||||||| |||| |
|
|
| T |
23419779 |
cctcttgtgtaaaaaacagggtaagactgcgtacaatacacca--aatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggc |
23419682 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
23419681 |
tgcccttt |
23419674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 28362250 - 28362155
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
28362250 |
cctcttgtgtaaaaaacttggtaaggctgcgtacaatacacca--aatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 34626302 - 34626206
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||| |||||||| ||||| || ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
34626302 |
aaaaacagggtaaggctgcgttcaatacaccaa--atggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgcccttttt |
34626206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 18512560 - 18512455
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||||||||| | |||||||||||||||||| ||||| || |||||||||||||| |||||| | |
|
|
| T |
18512560 |
caacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactg |
18512464 |
T |
 |
| Q |
101 |
ggttgccct |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
18512463 |
ggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 113
Target Start/End: Complemental strand, 38262300 - 38262194
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||| | ||||| | ||||||||||||||||| ||| |||||||||||||| || | || |||||||||||||||||||||||| || |
|
|
| T |
38262300 |
ctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaa--atgatgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggatt |
38262203 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
38262202 |
gcccttttt |
38262194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 14 - 110
Target Start/End: Complemental strand, 3469272 - 3469176
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||| ||||| |||||||||||| |||||| | ||||||||||||||||||| | ||||||||||| |
|
|
| T |
3469272 |
aaaaaacagggtacggttgcgtacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 18747520 - 18747621
Alignment:
| Q |
8 |
ttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
106 |
Q |
| |
|
|||||||||||| |||||||||||||| || ||||||||||| |||||||||||||||| |||| || ||||||||||||||||||||||||| ||| |
|
|
| T |
18747520 |
ttgtgtaaaaaagcagggtaaggctgcgtataatacaccaat--tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgc |
18747617 |
T |
 |
| Q |
107 |
cctt |
110 |
Q |
| |
|
|||| |
|
|
| T |
18747618 |
cctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 113
Target Start/End: Complemental strand, 27889399 - 27889314
Alignment:
| Q |
26 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||| || |||||||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttttt |
27889314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 35334915 - 35334818
Alignment:
| Q |
10 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| | |||||||||||||||||| ||||| || ||||| ||||||||||||||||||||| |||| |
|
|
| T |
35334915 |
gtgtaaaaaacagggtaagactgtgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 112
Target Start/End: Original strand, 40463908 - 40464012
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||||| | |||||||||||| || |||||||||| |||||||||||||||| | ||||| || ||||||||||||| ||||||||| ||| |
|
|
| T |
40463908 |
ctcttgtgtaaaaa-ctgggtaaggctgcgtataatacaccaa--atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagtt |
40464004 |
T |
 |
| Q |
105 |
gccctttt |
112 |
Q |
| |
|
|||||||| |
|
|
| T |
40464005 |
gccctttt |
40464012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 113
Target Start/End: Original strand, 19265855 - 19265950
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| |||||||||||||||||| |||| |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
19265855 |
aaaaagagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccta-catatgtgggagctttagtgcaccgggctgcccttttt |
19265950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 110
Target Start/End: Original strand, 42476913 - 42477005
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| ||||||||||||||||| || | | ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
42476913 |
aaaacaaggtaaggctgcgtacaatacaccaa--atggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 32233242 - 32233133
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || || | |||||||| ||||||||| |||||||| |||| ||||||| |||||||| ||||||||| |
|
|
| T |
32233242 |
caacctcttgtgtaaaaa-cagggtaaggcagcgtatattacaccaa--atggtgggattccttcccaaaccctgcatatgagggagcttcagtgcaccg |
32233146 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
32233145 |
ggctgcccttttt |
32233133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 35787373 - 35787268
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| || ||||||| ||| ||||||||||||| |||| ||||||||||||| |||| || ||||||||||||| | |||||||||| |
|
|
| T |
35787373 |
cctcttgtgtaaaaa-catggtaaggttgcgtacaatacaccaa--atggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggt |
35787277 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
35787276 |
tgccctttt |
35787268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 103
Target Start/End: Original strand, 38604557 - 38604654
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccggg |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||| ||||||| |||||||| || ||||| || |||||||||||||| ||||||||||| |
|
|
| T |
38604557 |
cctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgcaccggg |
38604653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 110
Target Start/End: Original strand, 11741835 - 11741927
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||||||| |||||||| || | ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
11741835 |
aaaatagggtaaggctgcgtacaatacaccaa--atggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 1408487 - 1408594
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||||||||| ||||| || ||||| | | ||||||| |||||| | |
|
|
| T |
1408487 |
cctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaa--atggtgggaccccttcccggaccctgcgtatgcagaatctttagttcaccggat |
1408584 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||| ||||| |
|
|
| T |
1408585 |
tgcctttttt |
1408594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 111
Target Start/End: Complemental strand, 14732920 - 14732821
Alignment:
| Q |
11 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| ||||||| || ||||||| |||| | |||||||||||||||||||||||| ||| |||| |
|
|
| T |
14732920 |
tgtaaaaaacagggtaaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtcctt |
14732822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 19266483 - 19266564
Alignment:
| Q |
7 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctt |
90 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||| ||| |||||| |||||||| ||||| || ||||||||||||| |
|
|
| T |
19266483 |
cttgcgtaaaaaacagggtaaggctgcgtacaatacacca--aattgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 26 - 111
Target Start/End: Complemental strand, 45019010 - 45018923
Alignment:
| Q |
26 |
aaggctgcatacaatacaccaataa--tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||| ||||||| ||||| || |||||| |||||||||| ||||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 26 - 112
Target Start/End: Original strand, 39123945 - 39124031
Alignment:
| Q |
26 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||| ||||| || |||| ||||||||| ||||||| | ||||||||| |
|
|
| T |
39123945 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgccctttt |
39124031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 64 - 113
Target Start/End: Original strand, 36602535 - 36602584
Alignment:
| Q |
64 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
36602584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 39093532 - 39093436
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||| |||||| |||||||| || | |||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacacca-taatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttttta |
39093436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 114
Target Start/End: Complemental strand, 13792250 - 13792147
Alignment:
| Q |
10 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| | ||||| ||||||||||| | |||| || ||||| |||||||| |||||||| | |||||| |
|
|
| T |
13792250 |
gtgtaaaaaacttggtaagactgcatacaatacaccca-aatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccct |
13792152 |
T |
 |
| Q |
110 |
tttta |
114 |
Q |
| |
|
||||| |
|
|
| T |
13792151 |
tttta |
13792147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 23231587 - 23231692
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||| | ||| |||||||||||||| |||| || ||||||| ||||||||||||||| || |
|
|
| T |
23231587 |
cctcttgtgtaaaatataaggtaaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagt |
23231684 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
23231685 |
ttcccttt |
23231692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 108
Target Start/End: Original strand, 33500556 - 33500645
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
|||||||||||| |||| ||| |||||| || ||||||||||||||||||| ||||| || ||||||||| ||| |||| ||||||||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtg--ccgggttgccc |
33500645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 47077917 - 47077853
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
47077917 |
aatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcctttttt |
47077853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 87
Target Start/End: Complemental strand, 48123589 - 48123508
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggag |
87 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
48123589 |
cctcttgtgtaaataacagggtaaaactgcatacaatacacca--aatggtgggacccctttctggaccatgcatatgcgggag |
48123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 4 - 101
Target Start/End: Complemental strand, 2663038 - 2662946
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
|||||||||||||| | |||||||||||| |||||||||||| |||||||||| ||||| ||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
2663038 |
cctcttgtgtaaaata--gggtaaggctgcgtacaatacacca--aatggtggga-cccttttcagaccctgcatatgcgggagctctagcgcaccgg |
2662946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 92
Target Start/End: Complemental strand, 28078227 - 28078151
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
92 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| ||||||||||||||||||| | || ||||||||| |||||||| |
|
|
| T |
28078227 |
aaaaaacagggtaaggttgcatgcaatacacca--aatggtgggaccccttcccgaatcctgcatatgcgagagcttta |
28078151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 3 - 71
Target Start/End: Complemental strand, 8149052 - 8148985
Alignment:
| Q |
3 |
acctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
71 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8149052 |
acctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcccagac |
8148985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 114
Target Start/End: Complemental strand, 23619039 - 23618974
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||||||||||||||| |||||| || | ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23619039 |
aatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttttta |
23618974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 66
Target Start/End: Original strand, 35203470 - 35203531
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||||| ||||| |||||||||| ||||||| |
|
|
| T |
35203470 |
ctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcc |
35203531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 1424011 - 1423967
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1424011 |
ttgtgtaaaaaacagggtaatgctgcatacactacaccaataatg |
1423967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 14099107 - 14099050
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
67 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14099107 |
ttgtgtaaaaaacaggttaagactgcgtacaatacacca--aatggtgggaccccttccc |
14099050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 14409124 - 14409067
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
67 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14409124 |
ttgtgtaaaaaacaggttaagactgcgtacaatacacca--aatggtgggaccccttccc |
14409067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 45811920 - 45811983
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||| ||||| |||||||| || ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45811920 |
aatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttttt |
45811983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 66
Target Start/End: Original strand, 7644986 - 7645047
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||| ||| |||||||||||||| |
|
|
| T |
7644986 |
cctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaa-aattgtgggaccccttcc |
7645047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 12473331 - 12473377
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
12473331 |
caacctcttgtgtcaaaaacagggtaaggatgcgtacaatacaccaa |
12473377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 27697464 - 27697572
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggg--accccttccc-agaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| || ||||||||| ||||||||| |||| ||||| |||||| || ||||||||||||| | |||| |
|
|
| T |
27697464 |
caacctcttgtgtaaaaatcagggcaaggctgtgta--atacaccaa-aatggtgggggaccctttccccagaccctgcgtatgcgggagcttaaatgca |
27697560 |
T |
 |
| Q |
98 |
ccgggttgccct |
109 |
Q |
| |
|
||||| |||||| |
|
|
| T |
27697561 |
ccgggatgccct |
27697572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 80 - 113
Target Start/End: Complemental strand, 44171668 - 44171635
Alignment:
| Q |
80 |
tgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44171668 |
tgcgggagctttagtgcaccgggttgcccttttt |
44171635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 113
Target Start/End: Original strand, 13805149 - 13805237
Alignment:
| Q |
22 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| ||||| ||||| || |||||||||||||| |||||| ||| | |||||||| |
|
|
| T |
13805149 |
gggtaaggctgtgtacaatacaccaa--atggtgggaccacttcctggaccctgcgtatgcgggagcttt-gtgcactgggctacccttttt |
13805237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 67
Target Start/End: Complemental strand, 17048914 - 17048859
Alignment:
| Q |
11 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
67 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||| |||||||| |||||||||| |
|
|
| T |
17048914 |
tgtaaaaaacagggtaaggttacgtacaatacaccaa-aatggtggaaccccttccc |
17048859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 112
Target Start/End: Complemental strand, 23066029 - 23065924
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||| ||||||||||| ||| | ||| |||||||||||| ||| ||||| ||||| || | || ||||||| ||||||||| ||||||||| || |
|
|
| T |
23066029 |
ctcttgtttaaaaaacaggataaagttgcgtacaatacacca--tatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggatt |
23065932 |
T |
 |
| Q |
105 |
gccctttt |
112 |
Q |
| |
|
|||||||| |
|
|
| T |
23065931 |
gccctttt |
23065924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 25198799 - 25198863
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||| ||| |||||||||||||| | |||| | |||||||||||||||||||||| |||||| |
|
|
| T |
25198799 |
aatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcacttttt |
25198863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 100
Target Start/End: Original strand, 25434050 - 25434144
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||| ||||||| |||||| ||| |||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
25434050 |
ctcttgtgcaaaaaacatggtaagagtgcatacaacacaccaa-aatggtatgacttcttcttggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 98
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
98 |
Q |
| |
|
|||||||||||||| ||| |||||| || ||||| |||||||| |||||||||||||||||| || | | ||||||| ||||||||||||| |
|
|
| T |
21139851 |
ctcttgtgtaaaaa-cagagtaaggttggatacagtacaccaa--atggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 97
Target Start/End: Complemental strand, 5180262 - 5180169
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||| ||||||| |||| | ||||||||| ||| | || | ||||| ||||||||| |||| |
|
|
| T |
5180262 |
cctcttgtgtcaaaaacagggtaagactgtgtacaacacaccaaaaatgattggacccctttccaaatcctacgtatgcaggagctttaatgca |
5180169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 108
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
60 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 87)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 125 - 247
Target Start/End: Original strand, 33049064 - 33049187
Alignment:
| Q |
125 |
taaaaataatatttct-aactgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaagcactccataccttgaaccg |
223 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33049064 |
taaaaataatatttcttaagtgaagttcaaaataagtaactgaagaccagttttttacatgtaactcttgcatatcctaagcactccataccttgaacca |
33049163 |
T |
 |
| Q |
224 |
cacactgtttcaaatgtctgtgct |
247 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
33049164 |
cacactgtttcaaatgtctttgct |
33049187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 16408708 - 16408599
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16408708 |
cctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggt |
16408609 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
16408608 |
tgcccttttt |
16408599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 23501817 - 23501926
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23501817 |
cctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggt |
23501916 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
23501917 |
tgcccttttt |
23501926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 4 - 108
Target Start/End: Original strand, 21646994 - 21647098
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21646994 |
cctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
21647093 |
T |
 |
| Q |
104 |
tgccc |
108 |
Q |
| |
|
||||| |
|
|
| T |
21647094 |
tgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 4 - 115
Target Start/End: Complemental strand, 13256506 - 13256395
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13256506 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggt |
13256407 |
T |
 |
| Q |
104 |
tgccctttttag |
115 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13256406 |
tgccctttttag |
13256395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 20639764 - 20639656
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
20639764 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
20639666 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
20639665 |
tgcccttttt |
20639656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 20225119 - 20225211
Alignment:
| Q |
19 |
acagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 5 - 114
Target Start/End: Original strand, 25629080 - 25629187
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25629080 |
ctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggtt |
25629177 |
T |
 |
| Q |
105 |
gcccttttta |
114 |
Q |
| |
|
|||||||||| |
|
|
| T |
25629178 |
gcccttttta |
25629187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 5 - 111
Target Start/End: Complemental strand, 48327869 - 48327763
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||| ||||||||| || |||||||||||||||| |
|
|
| T |
48327869 |
ctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggtt |
48327770 |
T |
 |
| Q |
105 |
gcccttt |
111 |
Q |
| |
|
|||||| |
|
|
| T |
48327769 |
acccttt |
48327763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 16911592 - 16911700
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || || |||||||||||||| ||||||| |
|
|
| T |
16911592 |
cctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggt |
16911691 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
16911692 |
tgccctttt |
16911700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 20225011 - 20225117
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
20225011 |
caacctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
20225106 |
T |
 |
| Q |
101 |
ggttgcccttt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
20225107 |
ggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 20405116 - 20405224
Alignment:
| Q |
4 |
cctcttgtgtaaaa-aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
20405116 |
cctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattggg |
20405215 |
T |
 |
| Q |
103 |
ttgcccttt |
111 |
Q |
| |
|
||||||||| |
|
|
| T |
20405216 |
ttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 44363237 - 44363130
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||| |||||||||||||||||| |||||| ||||| |||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
44363237 |
cctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
44363138 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
44363137 |
tgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 54175094 - 54175203
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag-accccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
54175094 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa-aatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccggg |
54175191 |
T |
 |
| Q |
103 |
ttgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
54175192 |
ctgcccttttta |
54175203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 47443987 - 47444094
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||| ||||||| ||||||| |||| |
|
|
| T |
47443987 |
cctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggt |
47444084 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
47444085 |
tgcccttttt |
47444094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 30639411 - 30639516
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
30639411 |
ctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggtt |
30639507 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
30639508 |
gcccttttt |
30639516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 5648289 - 5648396
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||| ||||||| |||| |
|
|
| T |
5648289 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggt |
5648385 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
5648386 |
tgcccttttta |
5648396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 109
Target Start/End: Complemental strand, 29208001 - 29207900
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
29208001 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
29207906 |
T |
 |
| Q |
104 |
tgccct |
109 |
Q |
| |
|
|||||| |
|
|
| T |
29207905 |
tgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 111
Target Start/End: Complemental strand, 30690272 - 30690176
Alignment:
| Q |
13 |
taaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||| || |||||||| |
|
|
| T |
30690272 |
taaaaaacagggtaaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 9987942 - 9987832
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
9987942 |
caacctcttgtgtaaacaatagggtaaggctgcatacaatacacca--aatggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccg |
9987845 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|| |||| ||||| |
|
|
| T |
9987844 |
ggctgcctttttt |
9987832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 9832416 - 9832310
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||| ||| || ||||||||||||| |
|
|
| T |
9832416 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggt |
9832321 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
9832320 |
tgcccttttta |
9832310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 110
Target Start/End: Complemental strand, 6430730 - 6430627
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |||||| ||||| || |||||||||||||||| ||||||||| |
|
|
| T |
6430730 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggt |
6430634 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
6430633 |
tgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 8473713 - 8473621
Alignment:
| Q |
18 |
aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag-acccc-gcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8473713 |
aacagggtaaggctgcatacaatacaccaa--atggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 34 - 113
Target Start/End: Complemental strand, 33836564 - 33836485
Alignment:
| Q |
34 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33836564 |
atacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcccttttt |
33836485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 47528633 - 47528528
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| | ||||| ||||||| ||||||||||||| |
|
|
| T |
47528633 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggt |
47528538 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
47528537 |
tgcccttttt |
47528528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 48598928 - 48598823
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| |||| |||||||| |||||| ||||||||||||| |
|
|
| T |
48598928 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggt |
48598833 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
48598832 |
tgcccttttt |
48598823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 17043499 - 17043393
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||| |||||| || |
|
|
| T |
17043499 |
cctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcatatgctggagcttta-tgcaccaggc |
17043403 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
||||| |||| |
|
|
| T |
17043402 |
tgcccctttt |
17043393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 10660431 - 10660543
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcacc |
99 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||||||||||||||||||| |||||||||| ||| || || |||||||||||||| |||||| | |
|
|
| T |
10660431 |
caacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatc |
10660529 |
T |
 |
| Q |
100 |
gggttgcccttttt |
113 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
10660530 |
gggttgcccctttt |
10660543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 10874576 - 10874688
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcacc |
99 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||||||||||||||||||| |||||||||| ||| || || |||||||||||||| |||||| | |
|
|
| T |
10874576 |
caacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatc |
10874674 |
T |
 |
| Q |
100 |
gggttgcccttttt |
113 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
10874675 |
gggttgcccctttt |
10874688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 19027875 - 19027973
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||| | || |||| |||||||||||||||||| |
|
|
| T |
19027875 |
caacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat--tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccg |
19027972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 51865143 - 51865037
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||| |||||||| ||||||||| ||||| || ||||||||||||||| |||||||| |
|
|
| T |
51865143 |
cctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaa--atggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggac |
51865046 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
51865045 |
tgccctttt |
51865037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 7 - 113
Target Start/End: Original strand, 35567203 - 35567307
Alignment:
| Q |
7 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |||| || | ||||||||||||||||||||||| ||| |
|
|
| T |
35567203 |
cttgtgtaaaaaacagggtaaggctgtgtacaacacaccaa--atggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgc |
35567300 |
T |
 |
| Q |
107 |
ccttttt |
113 |
Q |
| |
|
||||||| |
|
|
| T |
35567301 |
ccttttt |
35567307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 113
Target Start/End: Complemental strand, 11054241 - 11054146
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||| || |||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11054241 |
aaaacagggtaagactgcgtacaatacaccaa--atggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
11054146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 113
Target Start/End: Complemental strand, 30352681 - 30352578
Alignment:
| Q |
14 |
aaaaaacagggtaag----gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||| ||||||||||||||||| | ||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
30352681 |
aaaaaacagggtaagtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccct |
30352582 |
T |
 |
| Q |
110 |
tttt |
113 |
Q |
| |
|
|||| |
|
|
| T |
30352581 |
tttt |
30352578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 14983864 - 14983970
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||| || |||||||||||||||||| ||||| || |||||||||||||||||| ||| || |
|
|
| T |
14983864 |
cctcttgtgtaaaaaatagggtaaggttgcctacaatacactaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgt |
14983961 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
14983962 |
tgccctttt |
14983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 50 - 113
Target Start/End: Original strand, 32484307 - 32484370
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
32484370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 40915859 - 40915962
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||||||||| ||||||||| |||||||| ||||| || ||||||||||||| |||||||||| | |
|
|
| T |
40915859 |
cctcttgtgtaaaaa-caaggtaaggctgcgtacaatacaccaa--atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggat |
40915955 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
40915956 |
tgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 16494259 - 16494345
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||| | ||||||| |||||||||| |||||| |
|
|
| T |
16494259 |
aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 25463149 - 25463259
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||| ||||| ||||||| |||||||||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
25463149 |
caacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttt-gtgcacca |
25463245 |
T |
 |
| Q |
101 |
ggttgcccttttta |
114 |
Q |
| |
|
|| | ||||||||| |
|
|
| T |
25463246 |
ggctacccttttta |
25463259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 54730279 - 54730389
Alignment:
| Q |
4 |
cctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| || ||||||||||||||| ||| |||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
54730279 |
cctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccgaa |
54730378 |
T |
 |
| Q |
103 |
ttgcccttttt |
113 |
Q |
| |
|
|| |||||||| |
|
|
| T |
54730379 |
ttacccttttt |
54730389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 37494878 - 37494972
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| | ||||| || ||||| |||||||||||||| |
|
|
| T |
37494878 |
caacctcttgtgtaaaaaacagggtaaggttgcatacaatatacca--aatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 38755973 - 38755908
Alignment:
| Q |
46 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
38755973 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 93
Target Start/End: Complemental strand, 39029166 - 39029078
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| || |||||||||||| ||| || ||||| ||||||||||||||||||| |
|
|
| T |
39029166 |
cctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaa-aatggtgggaccactttccggaccctgcatatgcgggagctttag |
39029078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 113
Target Start/End: Complemental strand, 20908733 - 20908634
Alignment:
| Q |
13 |
taaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||| ||||||||||||||||||| |||| || ||||||||||||||||||||| || ||||||||| |
|
|
| T |
20908733 |
taaaaaagaaggtaaggctgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttt |
20908635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 25343218 - 25343326
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| || ||| ||||||||||| ||| || || |||| | ||||||||| ||||| || | |
|
|
| T |
25343218 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggct |
25343317 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
|||| |||| |
|
|
| T |
25343318 |
gcccctttt |
25343326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 38786682 - 38786746
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38786682 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
38786746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 110
Target Start/End: Complemental strand, 7909384 - 7909281
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc-gggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||| ||| |||||||||||| ||||||||||||||||||| |||| || ||||| ||||||||||||||| ||||| |
|
|
| T |
7909384 |
ctcttgtgtaaaaa-cagggtaaggttgcgtacaatacacca--aatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggt |
7909288 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
7909287 |
tgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 30581575 - 30581481
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
95 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||||||||| ||||||||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
30581575 |
caacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaa-aatggtgggaccccttcccggaccctgcatatgtaggagctttagtg |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 2 - 108
Target Start/End: Original strand, 54967049 - 54967151
Alignment:
| Q |
2 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| |||| ||||||||||||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
54967049 |
aacctcttgtgtaaaaaacagggtaaggttgc-tacaatatacca--aatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgg |
54967144 |
T |
 |
| Q |
102 |
gttgccc |
108 |
Q |
| |
|
| ||||| |
|
|
| T |
54967145 |
gctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 4 - 106
Target Start/End: Original strand, 21489117 - 21489218
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||| ||||||||||| ||||| |||| |||||| |||||| ||||||||||||||||||| |||| || |||||||||||||| |||||| |||| |
|
|
| T |
21489117 |
cctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcactgggt |
21489215 |
T |
 |
| Q |
104 |
tgc |
106 |
Q |
| |
|
||| |
|
|
| T |
21489216 |
tgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 5306768 - 5306658
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatg----cgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||||||||| |||||||||||||||||| ||||| || |||| ||||||||||| |||||| |
|
|
| T |
5306768 |
cctcttgtgtaaaat-cagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcacc |
5306672 |
T |
 |
| Q |
100 |
gggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5306671 |
gggttgcccttttt |
5306658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 11 - 114
Target Start/End: Complemental strand, 10277855 - 10277754
Alignment:
| Q |
11 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||| |||| ||| ||||||||| ||||||||||||| |||||| |||||||||||||||| ||||||||||||| | ||||| ||||| |||||||| |
|
|
| T |
10277855 |
tgtataaaataggataaggctgcgtacaatacaccaa--atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgccctt |
10277758 |
T |
 |
| Q |
111 |
ttta |
114 |
Q |
| |
|
|||| |
|
|
| T |
10277757 |
ttta |
10277754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 11394925 - 11394987
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
11394925 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 11404652 - 11404714
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
11404652 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 36816479 - 36816382
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||| || |||||||| |||||| ||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36816479 |
aaaaacagggcagggctgcgtacaatacaccaaaaa-ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttttt |
36816382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 60 - 114
Target Start/End: Original strand, 56322984 - 56323038
Alignment:
| Q |
60 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttttta |
56323038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 44718641 - 44718702
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt |
44718702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 28494224 - 28494288
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
28494224 |
aatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcctttttt |
28494288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 32478893 - 32478792
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||| |||||||||||||||||| ||||| || |||||||||||||| |||||||| |
|
|
| T |
32478893 |
caacctctagtgtaaaaa-cagggtaaggctg-----aatacaccaa--atggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccg |
32478803 |
T |
 |
| Q |
101 |
ggttgcccttt |
111 |
Q |
| |
|
||| ||||||| |
|
|
| T |
32478802 |
ggtggcccttt |
32478792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 39077899 - 39077794
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||| ||||| |||||| ||| ||| || ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
39077899 |
cctcttgtgtaaaa--cagggtaaggttgcgtacaatataccaa--atggtgagacatctttccggaccctgcatatgcgggagctctagtgcaccgggt |
39077804 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||| ||||| |
|
|
| T |
39077803 |
tgcctttttt |
39077794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 2813169 - 2813263
Alignment:
| Q |
18 |
aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||||||||| ||||| || || |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt |
2813263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 6 - 112
Target Start/End: Original strand, 7038084 - 7038188
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
105 |
Q |
| |
|
|||||||||||||| |||||||| || | ||||||||||||| ||||||||| | ||| ||| ||||| || ||| | ||||||||||||||| |||||| |
|
|
| T |
7038084 |
tcttgtgtaaaaaatagggtaagacttcgtacaatacaccaa-aatggtggggcacctacccggaccctgcgtatac-ggagctttagtgcactgggttg |
7038181 |
T |
 |
| Q |
106 |
ccctttt |
112 |
Q |
| |
|
||||||| |
|
|
| T |
7038182 |
ccctttt |
7038188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 113
Target Start/End: Original strand, 19027986 - 19028048
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||| ||||||| |||||| | ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttttt |
19028048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 93
Target Start/End: Complemental strand, 49938668 - 49938611
Alignment:
| Q |
35 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
93 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
49938668 |
tacaatacaccaa-aatggtgggaccccttcccataccctgcatatgcgggagctttag |
49938611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 61 - 113
Target Start/End: Original strand, 35532077 - 35532129
Alignment:
| Q |
61 |
ccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
35532129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 12711558 - 12711450
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||| |||||||||||||| |||||||| |||| ||||||||||||| |||| ||||||||||| |||||| || ||||||| | |||||||||||| |
|
|
| T |
12711558 |
caacatcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaa--atggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacc |
12711461 |
T |
 |
| Q |
100 |
gggttgccctt |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
12711460 |
cagttgccctt |
12711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 49796839 - 49796911
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctt |
90 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||||||||||||| |||| || ||||||||||||| |
|
|
| T |
49796839 |
aaaacatggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 46 - 113
Target Start/End: Complemental strand, 50555721 - 50555654
Alignment:
| Q |
46 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
50555721 |
aataatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttttt |
50555654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 111
Target Start/End: Complemental strand, 55766558 - 55766466
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||||||| |||||||||| | ||||||| ||||| |||| |||| || |||||| |||||||||||||||||| |||||||| |
|
|
| T |
55766558 |
aaacagggtaaggctgcgtacaatacactga--atggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgcccttt |
55766466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 91
Target Start/End: Complemental strand, 3580947 - 3580860
Alignment:
| Q |
2 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
||||||||||||||||| || |||||||||| | |||||||||| |||| | |||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
3580947 |
aacctcttgtgtaaaaaccatggtaaggctgtgtgcaatacacca--aatgctaggaccccttcccggaccctgcatatgtgggagcttt |
3580860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 112
Target Start/End: Complemental strand, 47482918 - 47482849
Alignment:
| Q |
43 |
accaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| || |||||||||||||| ||||| || | ||||||||| |
|
|
| T |
47482918 |
accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttt |
47482849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 108
Target Start/End: Original strand, 36589773 - 36589876
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||| |||||||| |||||||||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
36589773 |
cctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaa-aatggtgggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggc |
36589871 |
T |
 |
| Q |
104 |
tgccc |
108 |
Q |
| |
|
||||| |
|
|
| T |
36589872 |
tgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 8820578 - 8820629
Alignment:
| Q |
46 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| ||| ||||||||| |
|
|
| T |
8820578 |
aataatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 100
Target Start/End: Complemental strand, 30496409 - 30496333
Alignment:
| Q |
22 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||| |||| || |||| ||||||||||||||||| |
|
|
| T |
30496409 |
gggtaaggctgcatacaatacacca--aatggggggactccttcccggaccgtgcttatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 35894563 - 35894505
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
67 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
35894563 |
ttgtgtaaaaaacacggtaagtgtgcgtacaatacaccaa-aatggtgggaccccttccc |
35894505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 41018901 - 41018807
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| | ||||||||||||| || |||||||||||||||||||| || |||| || |||||||||||| |
|
|
| T |
41018901 |
caacctcttgtgtaaaatt-agggtaaggctacgtacaatacaccaa--atagtgggaccccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 6 - 66
Target Start/End: Complemental strand, 17079754 - 17079696
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| | | ||||||||||||| |||| |
|
|
| T |
17079754 |
tcttgtgtataaaacagggtaaggctgcatacaatacgcta--aatggtgggaccctttcc |
17079696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 47441634 - 47441568
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
73 |
Q |
| |
|
||||| |||||||| ||||||||||||| |||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
47441634 |
ctcttttgtaaaaatcagggtaaggctgtgtacaatacacca--aatggttggaccccttcccggaccc |
47441568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 51420601 - 51420646
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
46 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
51420601 |
caacctcttgtgtagaaaacagggtaaggctgggtacaatacacca |
51420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 60
Target Start/End: Original strand, 14590878 - 14590922
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggacc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
14590878 |
aaaaaacagggtaaggctgcatacaatacatca--aatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 111
Target Start/End: Complemental strand, 55830813 - 55830721
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||| ||||| |||||||||| | ||||||| ||||| |||| |||| || |||||| ||||||||||||||| || |||||||| |
|
|
| T |
55830813 |
aaacagggtaatgctgcgtacaatacactga--atggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgcccttt |
55830721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 487243 - 487135
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata-------atggtgggaccccttcccagaccccgcatatgcgggagctttag |
93 |
Q |
| |
|
|||||||||||||| |||||| ||||| ||||| |||||||||| || | |||| ||||||||||||| || | || ||||||||||||||| |
|
|
| T |
487243 |
caacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaatggtgggatggcgggaccccttcccggattctgcgaatgcgggagctttag |
487144 |
T |
 |
| Q |
94 |
tgcaccggg |
102 |
Q |
| |
|
||||||||| |
|
|
| T |
487143 |
tgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 7385581 - 7385499
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc |
88 |
Q |
| |
|
|||| ||||||||||| ||||||||| || | ||||||||||| |||||||||||| ||||| ||||| | ||||||||||| |
|
|
| T |
7385581 |
cctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaa--atggtgggaccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 110
Target Start/End: Original strand, 21003410 - 21003469
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||||| |||| |||||||||||| || | |||||||||||| |||||||||| ||||||| |
|
|
| T |
21003410 |
atggtgtgacctcttcccagaccctgcgtgtgcgggagcttt-gtgcaccgggctgccctt |
21003469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 111
Target Start/End: Complemental strand, 34257034 - 34256982
Alignment:
| Q |
59 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
34257034 |
ccccttctcagaccttgcacatgcgggagctttagtgcaccgggctgctcttt |
34256982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 75)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 13730709 - 13730600
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13730709 |
cctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggt |
13730610 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
13730609 |
tgcccttttt |
13730600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 49013580 - 49013471
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49013580 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggt |
49013481 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
49013480 |
tgcccttttt |
49013471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 353450 - 353351
Alignment:
| Q |
10 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
353450 |
gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 13628897 - 13628789
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
13628897 |
cctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
13628798 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
13628797 |
tgccctttt |
13628789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 40272920 - 40272810
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
40272920 |
caacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccg |
40272823 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40272822 |
ggttgcccttttt |
40272810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 14987009 - 14987116
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
14987009 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggt |
14987108 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
14987109 |
ttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 46421142 - 46421032
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||||||| |||||||||| |
|
|
| T |
46421142 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggt |
46421043 |
T |
 |
| Q |
103 |
ttgcccttttt |
113 |
Q |
| |
|
||||||||||| |
|
|
| T |
46421042 |
ttgcccttttt |
46421032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 29366827 - 29366719
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||| |||||||||||||||| |||| |
|
|
| T |
29366827 |
cctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggt |
29366728 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
29366727 |
tgccctttt |
29366719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 45786321 - 45786214
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||| |||||||||||||||||||| |
|
|
| T |
45786321 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggt |
45786222 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
45786221 |
tgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 53996674 - 53996562
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||| | || |||| |||||||||||||||||| |
|
|
| T |
53996674 |
caacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaa-aatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccg |
53996576 |
T |
 |
| Q |
101 |
ggttgcccttttta |
114 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
53996575 |
ggctgcccttttta |
53996562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 94
Target Start/End: Original strand, 9607255 - 9607345
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9607255 |
cctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 12914140 - 12914034
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||| |||||| ||||||||||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
12914140 |
cctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggt |
12914043 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
12914042 |
tgccctttt |
12914034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 54484742 - 54484851
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
54484742 |
cctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
54484839 |
T |
 |
| Q |
103 |
ttgcccttttta |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54484840 |
ttgcccttttta |
54484851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 10795530 - 10795423
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||| |||||||| ||| |
|
|
| T |
10795530 |
cctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggt |
10795431 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
10795430 |
tgcccttt |
10795423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 516461 - 516571
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa-tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| || ||| ||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
516461 |
cctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgaccctgcgtatgcgggagctttagtgcaccggg |
516560 |
T |
 |
| Q |
103 |
ttgcccttttt |
113 |
Q |
| |
|
||||||||||| |
|
|
| T |
516561 |
ttgcccttttt |
516571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 109
Target Start/End: Complemental strand, 8247794 - 8247688
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||| ||||| || |||||||||||||| ||||||| ||| |
|
|
| T |
8247794 |
cctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactggg |
8247695 |
T |
 |
| Q |
103 |
ttgccct |
109 |
Q |
| |
|
||||||| |
|
|
| T |
8247694 |
ttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 45139586 - 45139479
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| || || ||||||||| |||| |||||||| |
|
|
| T |
45139586 |
caacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcgggaacttt-gtgcaccg |
45139489 |
T |
 |
| Q |
101 |
ggttgccctt |
110 |
Q |
| |
|
|| ||||||| |
|
|
| T |
45139488 |
ggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 45948946 - 45948848
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| | ||||| || ||||||||||||||||||||||| |
|
|
| T |
45948946 |
caacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
45948849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 1217142 - 1217248
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||| ||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
1217142 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
1217237 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
1217238 |
tgcccttttta |
1217248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 54374454 - 54374343
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| |||||| ||||||||||||||||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
54374454 |
caacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaa-aatggtgggaccccttcccggaccctgcatatgcgggagctttagttcacca |
54374356 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|| |||| ||||| |
|
|
| T |
54374355 |
ggctgccattttt |
54374343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 15797274 - 15797379
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
15797274 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggt |
15797369 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
15797370 |
tgcccttttt |
15797379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 34771457 - 34771361
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttta |
34771361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 31592901 - 31593004
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
31592901 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
31592996 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
31592997 |
tgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 39203568 - 39203671
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
39203568 |
cctcttgtgtaaaa--cagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggt |
39203663 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
39203664 |
tgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 5173828 - 5173717
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||| ||||||||||| ||||||||| ||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
5173828 |
caacctcttgtgtaaaaa-caaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccg |
5173730 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5173729 |
ggttgcccttttt |
5173717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 16 - 110
Target Start/End: Complemental strand, 22123010 - 22122918
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
22123010 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 22609818 - 22609921
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| |||| || ||||||||||||| |||||||||||| |
|
|
| T |
22609818 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggt |
22609914 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
22609915 |
tgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 34420749 - 34420640
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||| |||| || |||| |||||||||||||||| || |
|
|
| T |
34420749 |
cctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaa-aatggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcacatggc |
34420651 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
34420650 |
tgcccttttta |
34420640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 113
Target Start/End: Original strand, 26869769 - 26869865
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||| || |||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26869769 |
aaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcccttttt |
26869865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 4 - 109
Target Start/End: Original strand, 26573179 - 26573282
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||| ||||| || |||||| ||||||||||||||| || |
|
|
| T |
26573179 |
cctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaat--tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggc |
26573276 |
T |
 |
| Q |
104 |
tgccct |
109 |
Q |
| |
|
|||||| |
|
|
| T |
26573277 |
tgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 100
Target Start/End: Complemental strand, 6411926 - 6411833
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| ||| ||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
6411926 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 112
Target Start/End: Original strand, 16735503 - 16735598
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||| | || ||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
16735503 |
aaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttt |
16735598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 24 - 113
Target Start/End: Complemental strand, 52926304 - 52926217
Alignment:
| Q |
24 |
gtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||| ||||||| ||||| || |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52926304 |
gtaaggctgcgtacaatacaccaa--atggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttttt |
52926217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 25944521 - 25944629
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||| ||||||||||| ||| ||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||| ||||||||||| ||||| || |
|
|
| T |
25944521 |
cctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaa-aatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggc |
25944619 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
25944620 |
tgcccttttt |
25944629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 6 - 113
Target Start/End: Original strand, 7943044 - 7943149
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
105 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||| ||| ||||||||| ||||| ||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
7943044 |
tcttgtctaaaaaacagggtaagactgcgtacaatacatcaa--atggtgggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttg |
7943141 |
T |
 |
| Q |
106 |
cccttttt |
113 |
Q |
| |
|
|| ||||| |
|
|
| T |
7943142 |
cctttttt |
7943149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 24851363 - 24851299
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttttt |
24851299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 33926135 - 33926224
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
95 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
33926135 |
cctcttgtgtaaaaa-cagggtaaggctgtgtacaatacacca-taatggtgggaccccttcctggaccctgcatatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 25517276 - 25517169
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||| || | || |||||| |||||||||| || |||||||||||||||||| || || || ||||| ||||||||||||||||||| |
|
|
| T |
25517276 |
cctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaa--atggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccggg |
25517179 |
T |
 |
| Q |
103 |
ttgccctttt |
112 |
Q |
| |
|
|||||||||| |
|
|
| T |
25517178 |
ttgccctttt |
25517169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 51 - 112
Target Start/End: Original strand, 30452892 - 30452953
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30452953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 9276316 - 9276419
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||| |||||| ||||| ||||| || ||||||||| ||||| ||| | |||| |
|
|
| T |
9276316 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcagggt |
9276411 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
9276412 |
tgcccttt |
9276419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 19731054 - 19731155
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||||||| || ||||||||||| ||||||||| | | ||||| ||||||||||||||||||| |
|
|
| T |
19731054 |
cctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacc--tattggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggc |
19731151 |
T |
 |
| Q |
104 |
tgcc |
107 |
Q |
| |
|
|||| |
|
|
| T |
19731152 |
tgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 54032667 - 54032570
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
54032667 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc--gaatggtgg------------gaccctgcgtatgcgggagctttagtgcaccg |
54032582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 829551 - 829452
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||| |||| |||| |||| | ||| ||||||||||||| ||||||||||||||||||| |||| || ||||| ||||||||||||||||| |
|
|
| T |
829551 |
caacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccg |
829453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 55401228 - 55401330
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||| |||| |||| || |||||||||| ||||||||||||||||| | |||| | |||||||||||||| ||||||||| |
|
|
| T |
55401228 |
cctcttgtgtaaaaaacaggttaagactgcgtataatacaccaa-aatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcaccgggc |
55401326 |
T |
 |
| Q |
104 |
tgcc |
107 |
Q |
| |
|
|||| |
|
|
| T |
55401327 |
tgcc |
55401330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 44403661 - 44403552
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | ||||| ||| ||||||||||||||||||| ||||| | ||||| | ||||||||||||||||| |
|
|
| T |
44403661 |
cctcttgtgtaaaagacaaggtaaggctgcggagaataccacaa-aatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggc |
44403563 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
|||| |||||| |
|
|
| T |
44403562 |
tgcctttttta |
44403552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 73
Target Start/End: Original strand, 47624094 - 47624160
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
73 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
47624094 |
cctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
47624160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 4495765 - 4495674
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4495765 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgg------------gaccctgcgtatgcgggagctttagtgcaccgggttgcc |
4495680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 56 - 112
Target Start/End: Complemental strand, 10484671 - 10484615
Alignment:
| Q |
56 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10484615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 24577930 - 24577994
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||| || ||||||||||| |||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
24577930 |
aatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttttt |
24577994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 24578020 - 24578084
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24578020 |
aatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttttt |
24578084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 26292384 - 26292490
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||||| | || ||| ||||||||| ||| ||||| |||||||| |||| |||||||||||| || ||||||||||||| |
|
|
| T |
26292384 |
cctcttgtgtaaaa--cagggtaagaccgcgtacgatacaccaa--atgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggt |
26292479 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
|| |||||||| |
|
|
| T |
26292480 |
tgtccttttta |
26292490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 30928252 - 30928167
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
|||||||||||||||||| ||||||| || || ||||||||||| ||| ||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
30928252 |
cctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaat--tggcgggaccccttcccggaccctgcatatgtgggagcttt |
30928167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 35417999 - 35418063
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||||||||| |||| ||||| |||| |
|
|
| T |
35417999 |
aatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgcccatttt |
35418063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 8410966 - 8410887
Alignment:
| Q |
10 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | |||||||||| |||| ||||||| ||||| |||| |||||| |
|
|
| T |
8410966 |
gtgtaaaaaacagggtaaggctgctcacaatacacca--actggtgggacctcttctcagaccctgcataggcggaagcttt |
8410887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 12525459 - 12525566
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||| ||||||||||| |||||| |||||| | ||| ||||||||| | |||||| ||| |
|
|
| T |
12525459 |
cctcttgtgtaaaaatcagggtaaggctgcgaag--tacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactgcaccaggt |
12525556 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
||| |||||| |
|
|
| T |
12525557 |
tgctcttttt |
12525566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 63 - 113
Target Start/End: Original strand, 47624208 - 47624258
Alignment:
| Q |
63 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
47624258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 50625058 - 50624951
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||| |||| ||||||||| || |||||||||||| | ||||||||| |||||| | ||| || || | |||||||||||||||||||| |
|
|
| T |
50625058 |
cctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatt--tggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcaccgggc |
50624961 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
50624960 |
tgcccttttt |
50624951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 110
Target Start/End: Complemental strand, 31904955 - 31904857
Alignment:
| Q |
11 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga-ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||| |||||||||| |||||||||||| | | | |||||||||||||||||||| || |||||| |
|
|
| T |
31904955 |
tgtaaaaaacagggtatgactgcgtacaatacacca--aatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgcaccaggctgccct |
31904858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 19751630 - 19751731
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| || ||||||| ||| ||||||||||| || ||||||||||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
19751630 |
cctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacc--tattggtgggaccctttcccagactttgtgtatgcatgagctttagtgcaccgggc |
19751727 |
T |
 |
| Q |
104 |
tgcc |
107 |
Q |
| |
|
|||| |
|
|
| T |
19751728 |
tgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 33235583 - 33235687
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||| || |||||||||||||| | |||||| | ||||||| |||||||||||||| || |
|
|
| T |
33235583 |
cctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaa--atggtgggacccct-cgcagaccttacgtatgcggaagctttagtgcaccagg |
33235679 |
T |
 |
| Q |
103 |
ttgccctt |
110 |
Q |
| |
|
|||||||| |
|
|
| T |
33235680 |
ttgccctt |
33235687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 78 - 113
Target Start/End: Original strand, 40390365 - 40390400
Alignment:
| Q |
78 |
tatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40390365 |
tatgcgggagctttagtgcaccgggttgcccttttt |
40390400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 112
Target Start/End: Original strand, 40968613 - 40968676
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||||||||||||||| || | ||||||||| |
|
|
| T |
40968613 |
aatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgccctttt |
40968676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 52428582 - 52428539
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
52428582 |
cctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaa |
52428539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 97
Target Start/End: Complemental strand, 43114975 - 43114882
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaagg-ctgcatacaatacaccaataatggtgggaccccttcccagacccc-gcatatgcgggagctttagtgca |
97 |
Q |
| |
|
|||||||||||||||| |||||||||| || | ||||||||||||| |||||||||||| |||| |||||| || |||||||||||||||||||| |
|
|
| T |
43114975 |
cctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaa--atggtgggaccc-ttcctggacccctgcgtatgcgggagctttagtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 45620934 - 45620889
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaat |
48 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45620934 |
cctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaat |
45620889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 113
Target Start/End: Complemental strand, 6242327 - 6242283
Alignment:
| Q |
69 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
6242327 |
gaccctgcatatgcaggagctctagtgcaccgggttgcccttttt |
6242283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 113
Target Start/End: Complemental strand, 43956514 - 43956470
Alignment:
| Q |
69 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43956514 |
gacccagcgtatgcgggagctttagtgcaccgggctgcccttttt |
43956470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 111
Target Start/End: Original strand, 31831301 - 31831343
Alignment:
| Q |
69 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31831301 |
gaccctgcatatgcgggtgctctagtgcaccgggttgcccttt |
31831343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 52 - 113
Target Start/End: Complemental strand, 10696272 - 10696211
Alignment:
| Q |
52 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||| || | | ||||||| ||||||||| || |||||||||| |
|
|
| T |
10696272 |
ggtgggaccccttcccagaccctgcgtctacgggagcattagtgcactaggctgcccttttt |
10696211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 111
Target Start/End: Complemental strand, 14266405 - 14266372
Alignment:
| Q |
78 |
tatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
14266405 |
tatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 111
Target Start/End: Original strand, 23871490 - 23871523
Alignment:
| Q |
78 |
tatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23871490 |
tatgcgggaactttagtgcaccgggttgcccttt |
23871523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 110
Target Start/End: Original strand, 16130329 - 16130432
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
105 |
Q |
| |
|
|||| |||||||| |||| ||||||||| |||||||||||| ||||||||||||| ||| ||||| || || | |||||||||||||| ||| || |
|
|
| T |
16130329 |
tcttctgtaaaaagcaggataaggctgcgaacaatacaccaa-aatggtgggaccctgtcctagaccttgcgtacacaggagctttagtgcattgggctg |
16130427 |
T |
 |
| Q |
106 |
ccctt |
110 |
Q |
| |
|
||||| |
|
|
| T |
16130428 |
ccctt |
16130432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 21875062 - 21875106
Alignment:
| Q |
1 |
caacctcttgtgt-aaaaaacagggtaaggctgcatacaatacac |
44 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
21875062 |
caacctcttgtgttaaaaaagagggtaaggctgcgtacaatacac |
21875106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 31831251 - 31831292
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31831251 |
cctcttgtgtaaaata--gggtaaggctgcatacaatacaccaa |
31831292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 97
Target Start/End: Complemental strand, 46170029 - 46169981
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||| |||||||| |||||| |
|
|
| T |
46170029 |
aatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca |
46169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 55)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 7136637 - 7136525
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7136637 |
caacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
7136538 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
7136537 |
ggttacccttttt |
7136525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 20869954 - 20870062
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20869954 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggtt |
20870053 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
20870054 |
gcccttttt |
20870062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 6760852 - 6760961
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6760852 |
cctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggt |
6760951 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
6760952 |
tgcccttttt |
6760961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 26954162 - 26954271
Alignment:
| Q |
4 |
cctcttgtgtaaaa-aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
26954162 |
cctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactggg |
26954261 |
T |
 |
| Q |
103 |
ttgccctttt |
112 |
Q |
| |
|
|||||||||| |
|
|
| T |
26954262 |
ttgccctttt |
26954271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 39461101 - 39460993
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
39461101 |
cctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
39461002 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
39461001 |
tgccctttt |
39460993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 16225049 - 16225156
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16225049 |
cctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggt |
16225148 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|| ||||| |
|
|
| T |
16225149 |
tgtccttt |
16225156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 25250556 - 25250662
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25250556 |
ttgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcc |
25250655 |
T |
 |
| Q |
108 |
cttttta |
114 |
Q |
| |
|
||||||| |
|
|
| T |
25250656 |
cttttta |
25250662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 44530176 - 44530285
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
44530176 |
caacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccg |
44530273 |
T |
 |
| Q |
101 |
ggttgccctttt |
112 |
Q |
| |
|
||||| |||||| |
|
|
| T |
44530274 |
ggttgacctttt |
44530285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 28817731 - 28817623
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||| ||||| || |||||||||||||||||||| ||||| |
|
|
| T |
28817731 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccca--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggt |
28817634 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
28817633 |
tgcccttttta |
28817623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 12625916 - 12626026
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||| |||| ||||| || |||||||||||||||||||||| |
|
|
| T |
12625916 |
caacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaa--atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcacc |
12626013 |
T |
 |
| Q |
100 |
gggttgccctttt |
112 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12626014 |
gggttgccctttt |
12626026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 35261710 - 35261816
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
35261710 |
ctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggtt |
35261807 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
35261808 |
gcccttttt |
35261816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 36720826 - 36720932
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||| |||||||||||||| ||| |
|
|
| T |
36720826 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggt |
36720923 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
36720924 |
tgccctttt |
36720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 8897872 - 8897762
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| | ||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
8897872 |
caaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttactgcaccc |
8897775 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8897774 |
ggttgcccttttt |
8897762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 29521790 - 29521685
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| ||| |||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
29521790 |
cctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggt |
29521693 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
||| |||| |
|
|
| T |
29521692 |
tgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 12670353 - 12670248
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
12670353 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
12670258 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
| |||||||| |
|
|
| T |
12670257 |
tacccttttt |
12670248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 14 - 105
Target Start/End: Complemental strand, 20284166 - 20284075
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
105 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
20284166 |
aaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 14 - 105
Target Start/End: Complemental strand, 21070794 - 21070703
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
105 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
21070794 |
aaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 8484046 - 8483947
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||| |||||||||| || |||||||||||||||| |||||| |
|
|
| T |
8484046 |
caacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccg |
8483949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 44781614 - 44781517
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |||| ||||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
44781614 |
caacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 13160732 - 13160836
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||| ||||| |||||| |
|
|
| T |
13160732 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggt |
13160828 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
13160829 |
tgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 30454200 - 30454095
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||| ||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
30454200 |
cctcttgtgtaaaa--caaggtaaggctgcgtacgatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
30454105 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
30454104 |
tgcccttttt |
30454095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 45071295 - 45071398
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| |||| || ||||||||||||| |||||||||||| |
|
|
| T |
45071295 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggt |
45071391 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
45071392 |
tgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 29877128 - 29877227
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||| |||||||||| || |||| |
|
|
| T |
29877128 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgcc |
29877225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 10857858 - 10857967
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
10857858 |
cctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaat--tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccggg |
10857955 |
T |
 |
| Q |
103 |
ttgcccttttta |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10857956 |
ttgcccttttta |
10857967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 5135394 - 5135287
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||| |||||||| |||||||||| |
|
|
| T |
5135394 |
cctcttgtgtaaaaaagagggtaaggctgtgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtgcaccgggc |
5135298 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
5135297 |
tgcccttttta |
5135287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 111
Target Start/End: Original strand, 2626562 - 2626657
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||| |||||||||||||||||||| |||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
2626562 |
aaaaaacagggtaagactgcgtacaatacaccaa--atgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 108
Target Start/End: Complemental strand, 17250982 - 17250879
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||| |||||| || ||||||||||||||||||||||||||| ||||| |||| || |||| |||||||||||||| ||||| |
|
|
| T |
17250982 |
cctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgca-cgggt |
17250884 |
T |
 |
| Q |
104 |
tgccc |
108 |
Q |
| |
|
||||| |
|
|
| T |
17250883 |
tgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 17823606 - 17823711
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||| |||| |||| || |||||||||| ||||||| |||||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
17823606 |
cctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaa--atggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggt |
17823703 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
17823704 |
tgcccttt |
17823711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 35 - 114
Target Start/End: Original strand, 16013515 - 16013594
Alignment:
| Q |
35 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||||||||| || |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16013515 |
tacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttta |
16013594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 19729382 - 19729476
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||| |||||||| |||||||| || |||||||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccctttt |
19729476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 9 - 114
Target Start/End: Complemental strand, 44742619 - 44742515
Alignment:
| Q |
9 |
tgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||| | |||||||||| ||||||||||||| ||||| |
|
|
| T |
44742619 |
tgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-aatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc |
44742521 |
T |
 |
| Q |
109 |
ttttta |
114 |
Q |
| |
|
||||| |
|
|
| T |
44742520 |
ctttta |
44742515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 34 - 113
Target Start/End: Original strand, 26102577 - 26102654
Alignment:
| Q |
34 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26102577 |
atacaatacaccaa--atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttttt |
26102654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 106
Target Start/End: Original strand, 5689661 - 5689761
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |||||||| |||||||||| ||| || |||| ||||||||||||||||||| | |
|
|
| T |
5689661 |
cctcttgtgtaaaaagcagggtaaggctgcgtacaatacacca--aatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtt |
5689758 |
T |
 |
| Q |
104 |
tgc |
106 |
Q |
| |
|
||| |
|
|
| T |
5689759 |
tgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 43942354 - 43942421
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
71 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43942354 |
cctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagac |
43942421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 31457200 - 31457308
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||| ||| ||||| ||||||||||||| |||| || |||||||||||| |||||||||| |
|
|
| T |
31457200 |
caacctcttgtgtaaaaat-aggaaaaggctgcgtacaatacatcaa--atggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccg |
31457296 |
T |
 |
| Q |
101 |
ggttgccctttt |
112 |
Q |
| |
|
| |||||||||| |
|
|
| T |
31457297 |
gattgccctttt |
31457308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 18164864 - 18164758
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||| ||| ||||||||||||| | | || |||| ||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
18164864 |
cctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaa--aggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
18164768 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||| ||||| |
|
|
| T |
18164767 |
tgccattttt |
18164758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 100
Target Start/End: Complemental strand, 24365165 - 24365071
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||| ||||| || |||| ||||||||| |||||||| |
|
|
| T |
24365165 |
cctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgcaccg |
24365071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 22598184 - 22598279
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| ||||| |||| || ||||||||| |||||||||||| |
|
|
| T |
22598184 |
caacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaat--tggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 28407476 - 28407538
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
28407476 |
aatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 101
Target Start/End: Original strand, 389673 - 389770
Alignment:
| Q |
4 |
cctcttgtgt--aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||||||||| |||| ||||| ||||| || ||||| || |||||| ||||||||||||||||| |
|
|
| T |
389673 |
cctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacacca--aatgatgggatccctttcctgaccctgcgtatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 23000323 - 23000228
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| || ||||||| | ||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23000323 |
cctcttgtgtaaaaa-cacggtaaggttccatacaatacaccaa--atggtgggaccccttcccgga---------tgcgggagctttagtgcaccgggt |
23000236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 33866983 - 33867087
Alignment:
| Q |
8 |
ttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
106 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| || ||||||| || |||||| |||| || ||||| | ||||||||||||||||||||| |
|
|
| T |
33866983 |
ttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgc |
33867082 |
T |
 |
| Q |
107 |
ccttt |
111 |
Q |
| |
|
||||| |
|
|
| T |
33867083 |
ccttt |
33867087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 62 - 113
Target Start/End: Complemental strand, 27468141 - 27468090
Alignment:
| Q |
62 |
cttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
27468090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 35107373 - 35107310
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||||| ||| | | ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35107373 |
aatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 113
Target Start/End: Original strand, 26457776 - 26457864
Alignment:
| Q |
21 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| || |||| || |||| |||||||||||||||||||||| || ||||| |
|
|
| T |
26457776 |
agggtaaggctgcgtacaatacaccaat--tggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtttcctttttt |
26457864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 88
Target Start/End: Complemental strand, 20869601 - 20869523
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc |
88 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| |||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
20869601 |
cctcttgtgtaaaa--cagggtaaggctgtgtacaatacaccaa----ggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 90
Target Start/End: Complemental strand, 14018073 - 14017989
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctt |
90 |
Q |
| |
|
||||||||||||||||||||| || |||| |||||||||| || | |||||||||| ||||| ||||| ||| |||||| ||||| |
|
|
| T |
14018073 |
ctcttgtgtaaaaaacagggtgagactgcgtacaatacactaa-attggtgggaccacttcctggaccctgcagatgcggtagctt |
14017989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 35105950 - 35106014
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
||||||||||||||||| | || |||||||||| ||||||||||| | |||||||||||| ||||| |
|
|
| T |
35105950 |
caacctcttgtgtaaaagagagtgtaaggctgcgtacaatacacc-agaatggtgggacctcttcc |
35106014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 110
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||||||||| |||||| |||| || ||||| ||||||||||||| ||||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 111
Target Start/End: Complemental strand, 23286379 - 23286337
Alignment:
| Q |
69 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23286379 |
gaccctgcatatgcgggagctctagtgcaccgggctgcccttt |
23286337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 42083800 - 42083699
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||| ||| |||||||| |||| || ||||| ||||||||||||||||||| |||| | || | ||||||||||||||| ||| |||| |
|
|
| T |
42083800 |
ttgtgtaaaaaatggggcaaggctgcgtacagtataccaa-aatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgcattgggctgcc |
42083702 |
T |
 |
| Q |
108 |
ctt |
110 |
Q |
| |
|
||| |
|
|
| T |
42083701 |
ctt |
42083699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 2351780 - 2351719
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |||| |||||| |||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
2351780 |
aatggtgggaccc-ttcctagaccctgcat--gcgggagctttagtgcaccgagttgtccttttt |
2351719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 56 - 113
Target Start/End: Original strand, 18595918 - 18595975
Alignment:
| Q |
56 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||| ||||| | |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcctttttt |
18595975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 36918156 - 36918197
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36918156 |
tcttatgtaaaaaacagggtaaggctgtgtacaatacaccaa |
36918197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 64)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 4619211 - 4619103
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4619211 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggt |
4619112 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
4619111 |
tgccctttt |
4619103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 13801874 - 13801767
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13801874 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggt |
13801775 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
13801774 |
tgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 38879611 - 38879719
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
38879611 |
cctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
38879710 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
38879711 |
tgccctttt |
38879719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 4 - 110
Target Start/End: Original strand, 20135634 - 20135740
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
20135634 |
cctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggt |
20135733 |
T |
 |
| Q |
104 |
tgccctt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
20135734 |
tgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 12006438 - 12006329
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
12006438 |
caacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccg |
12006339 |
T |
 |
| Q |
101 |
ggttgccctt |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
12006338 |
tgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 41014349 - 41014454
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014349 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggt |
41014445 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
41014446 |
tgccctttt |
41014454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 14 - 114
Target Start/End: Original strand, 43334243 - 43334342
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43334243 |
aaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgcccttttt |
43334341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 5 - 112
Target Start/End: Original strand, 27328783 - 27328890
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| || ||||||||||||||| |||| ||| || |
|
|
| T |
27328783 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggatt |
27328882 |
T |
 |
| Q |
105 |
gccctttt |
112 |
Q |
| |
|
||| |||| |
|
|
| T |
27328883 |
gccttttt |
27328890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 24448924 - 24449027
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
24448924 |
ttgtgtaaaaaatagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcc |
24449021 |
T |
 |
| Q |
108 |
cttttt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
24449022 |
cttttt |
24449027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 32703454 - 32703558
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
32703454 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
32703549 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
32703550 |
tgccctttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 8170077 - 8169981
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8170077 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttttta |
8169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 16880752 - 16880647
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||| |||| |||||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
16880752 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggt |
16880655 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
16880654 |
ttcccttt |
16880647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 108
Target Start/End: Original strand, 7368428 - 7368528
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
7368428 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggt |
7368523 |
T |
 |
| Q |
104 |
tgccc |
108 |
Q |
| |
|
||||| |
|
|
| T |
7368524 |
tgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 34154903 - 34154814
Alignment:
| Q |
20 |
cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34154903 |
cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 5 - 102
Target Start/End: Original strand, 43574637 - 43574732
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| ||||| |||||||||||||||||| ||||| || |||||||||||||||| |||||||| |
|
|
| T |
43574637 |
ctcttgtgtagaaaacagggtaaggctgcgtacaatataccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 28516539 - 28516432
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||| ||| ||||||||||||| ||||||||||| || |||| |||||||||||| ||| ||| |
|
|
| T |
28516539 |
cctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaa-aatggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggt |
28516441 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
28516440 |
tgccctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 29334425 - 29334532
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| | ||||||||||||| ||||| ||||| || |||| |||| ||||| ||||||||| |
|
|
| T |
29334425 |
cctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacc-agaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggc |
29334523 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
29334524 |
tgccctttt |
29334532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 40 - 111
Target Start/End: Original strand, 25622524 - 25622595
Alignment:
| Q |
40 |
tacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 35710343 - 35710448
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| | |||||||||||| | ||||||||||| |||||||||||||||||| || | ||||||||||||||| ||||||||||||| |
|
|
| T |
35710343 |
cctcttgtgtaaaata--gggtaaggctgcgttcaatacaccaa--atggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggt |
35710438 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
35710439 |
tgcccttttt |
35710448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 112
Target Start/End: Original strand, 16957375 - 16957450
Alignment:
| Q |
35 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16957375 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
16957450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 209035 - 208936
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||| ||||| | ||||| |||||||||||||||| |
|
|
| T |
209035 |
caacctcttgtgtaaaaa-cagggtaaggctgcattcaatacaccaa-aatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccg |
208938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 19143050 - 19142941
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| |||||||| |||||||||||||||||| |||| || |||||||||| |||||||||| | |
|
|
| T |
19143050 |
caacctcttgtgtaaaaa-cagggtaaggctgcgtacagtacaccaa--atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcactg |
19142954 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
| |||||||||| |
|
|
| T |
19142953 |
gcctgcccttttt |
19142941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 42924942 - 42924830
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag--accccgcatatgcgggagctttagtgcac |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| ||||||||||||| |||| ||| | |||||||||| |||| || ||||||| ||||||||||||| |
|
|
| T |
42924942 |
caacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtgcac |
42924843 |
T |
 |
| Q |
99 |
cgggttgcccttt |
111 |
Q |
| |
|
||| ||| ||||| |
|
|
| T |
42924842 |
cggattgtccttt |
42924830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 41425982 - 41426043
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41425982 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaat--tggtgggaccccttcccagac |
41426043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 24 - 113
Target Start/End: Complemental strand, 11657785 - 11657697
Alignment:
| Q |
24 |
gtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| ||| | |||||| ||||||| ||||||| |||||||||| |
|
|
| T |
11657785 |
gtaaggctgcatacaatacaccaa-aatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttttt |
11657697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 52 - 113
Target Start/End: Complemental strand, 16028683 - 16028622
Alignment:
| Q |
52 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
16028622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 99
Target Start/End: Complemental strand, 7097864 - 7097772
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||||||| |||||||||| ||| ||||||||||||| |||||| ||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
7097864 |
cctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaa--atggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 112
Target Start/End: Original strand, 3771379 - 3771475
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||| | | |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3771379 |
aaaaaacagggtaaggctgtgaacaatacaccaat--tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctttt |
3771475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 22187315 - 22187422
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| | |||| |||| ||||||||||||| || || |||||||||||| |||| ||||||| |||||||||||||| | ||| |
|
|
| T |
22187315 |
cctcttgtgtaaaaaacatgataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggt |
22187414 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
22187415 |
tgcccttt |
22187422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 101
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || |||||| |||||| ||||||| |||||||| | |||||||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaa--atagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 51 - 112
Target Start/End: Original strand, 39801591 - 39801652
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttt |
39801652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 1565458 - 1565566
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||| |||||||| || ||||||||| |||||| |||||| |||| ||||||||||||| ||||| ||||||| |||||| |||||||||| |
|
|
| T |
1565458 |
caacctcttgagtaaaaaaacatattaaggctgcgtacaatgcaccaa--atggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcacc |
1565554 |
T |
 |
| Q |
100 |
gggttgcccttt |
111 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1565555 |
gggttgcccttt |
1565566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 12575767 - 12575660
Alignment:
| Q |
4 |
cctcttgtgtaaa-aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||| ||||| ||||||| ||| | ||| ||||||||||||| |||||||||||||||||| ||||| || ||||| |||||||| |||||||||| |
|
|
| T |
12575767 |
cctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaa-aatggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccggg |
12575669 |
T |
 |
| Q |
103 |
ttgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
12575668 |
ctgcccttt |
12575660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 30877628 - 30877564
Alignment:
| Q |
47 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30877628 |
ataaaggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt |
30877564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 24323813 - 24323725
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| || ||||| |||| || ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24323813 |
caacctcttgtgtaaaagacagggtaagcttgcgtataatactccaa--atagtgggaccccttcccagaccctgtatatgcgggagcttt |
24323725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 24360437 - 24360349
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| || ||||| |||| || ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24360437 |
caacctcttgtgtaaaagacagggtaagcttgcgtataatactccaa--atagtgggaccccttcccagaccctgtatatgcgggagcttt |
24360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 1405214 - 1405324
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||| | ||||||| || ||||| ||| ||||||||||||| |||||||||||| |||| |||| ||||||||||||||| |||| ||||| |
|
|
| T |
1405214 |
caacctcttatataaaaaatagagtaagtttgcgtacaatacaccaa--atggtgggaccctttcctgaaccctgcatatgcgggagctctagtacaccg |
1405311 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
1405312 |
gattgcccttttt |
1405324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 39301150 - 39301249
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| || ||| |||||| || |||||||||||||||| ||||| | |||| ||||| |||||||||||| |
|
|
| T |
39301150 |
caacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaa-aaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccg |
39301247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 22600488 - 22600569
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| |||||||||| |||||||| || || || |||||||||||||| |
|
|
| T |
22600488 |
ttgtgtaaaacacagggtaaggctgtgtacaatacacca--aatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 6 - 88
Target Start/End: Original strand, 2838811 - 2838890
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||| |||||||||| |||||| | ||||| || ||||||||||| |
|
|
| T |
2838811 |
tcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 30006352 - 30006456
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |||| ||||| || |||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
30006352 |
caacctcttatataaacaacagggtaaggctgtgtacattacactaa--atggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccg |
30006449 |
T |
 |
| Q |
101 |
ggttgcc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
30006450 |
ggttgcc |
30006456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 55 - 113
Target Start/End: Complemental strand, 10943900 - 10943843
Alignment:
| Q |
55 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttttt |
10943843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 99
Target Start/End: Complemental strand, 31694207 - 31694120
Alignment:
| Q |
10 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||| || || |||||| |||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
31694207 |
gtgtaaaaaataggctaaagctgcatacaatacacctat--tgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc |
31694120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 5873426 - 5873322
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| ||| ||| ||| | || |||||||||||||||||||| |||| |
|
|
| T |
5873426 |
cctcttgtgtaaaaat-agggtaaggctaagtacactacaccaat--tggtgggactcctccccggacactgcgtatgcgggagctttagtgcatcggga |
5873330 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
5873329 |
tgcccttt |
5873322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 92
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
| Q |
36 |
acaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
92 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
10306548 |
acaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 60 - 112
Target Start/End: Original strand, 32354211 - 32354263
Alignment:
| Q |
60 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
32354263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 108
Target Start/End: Complemental strand, 21784394 - 21784335
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||| |||||||||||| ||||||| |
|
|
| T |
21784394 |
aatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 22861731 - 22861668
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
22861731 |
aatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgccctttt |
22861668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
25 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| || | || ||||| ||||||||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaa-aatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 24903797 - 24903694
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||| |||||||| || |||||| ||||||| ||||| ||||||||||| ||| | ||||| |||||| |||| |||||||||| || | |
|
|
| T |
24903797 |
ttgtgtaaaaaatagggtaagattgtgtacaatccaccaat--tggtgagaccccttcccggacactgcatacgcgggaactttggtgcaccgggctgtc |
24903700 |
T |
 |
| Q |
108 |
cttttt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
24903699 |
cttttt |
24903694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 71
Target Start/End: Complemental strand, 22907969 - 22907904
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccct-tcccagac |
71 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
22907969 |
cctcttgtgtaaaaa-cagagtaaggttgcatacaatacacca--aatggtgggacccctctcccagac |
22907904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 101
Target Start/End: Original strand, 1850668 - 1850764
Alignment:
| Q |
2 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||| ||||||||| ||| ||||||||||| ||||| ||||| || |||||| |||||||||||||||| |
|
|
| T |
1850668 |
aacctcttgtgtaaaaa-cagaataagggtgcgtacaatacatcaa--atggtgggaccacttcctggaccctgcggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 110
Target Start/End: Complemental strand, 29184094 - 29184062
Alignment:
| Q |
78 |
tatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29184094 |
tatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 99
Target Start/End: Original strand, 29297862 - 29297914
Alignment:
| Q |
47 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| || |||| ||||||||||||| |
|
|
| T |
29297862 |
ataatggtgggatcccttcccggaccccgcaaatacgggtgctttagtgcacc |
29297914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 99
Target Start/End: Complemental strand, 4654477 - 4654427
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||| |||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
4654477 |
aatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc |
4654427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 109
Target Start/End: Original strand, 11462924 - 11462958
Alignment:
| Q |
75 |
gcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11462924 |
gcatatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 106
Target Start/End: Original strand, 18684361 - 18684403
Alignment:
| Q |
64 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
106 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
18684361 |
tcccagaccctgcgtatgcgggagctttagtgcatcgggttgc |
18684403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 11 - 64
Target Start/End: Complemental strand, 2432395 - 2432342
Alignment:
| Q |
11 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
64 |
Q |
| |
|
||||||||||| || |||| |||||| |||||||||| |||||||| ||||||| |
|
|
| T |
2432395 |
tgtaaaaaacaaggcaagggtgcatataatacaccaaaaatggtggaacccctt |
2432342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 69 - 110
Target Start/End: Original strand, 19438759 - 19438800
Alignment:
| Q |
69 |
gaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
19438759 |
gaccctgcatatgcgggagctctagtgcaccaggttgccctt |
19438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 113
Target Start/End: Original strand, 19093894 - 19093950
Alignment:
| Q |
57 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||| ||| ||||| || |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19093894 |
gacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgcccttttt |
19093950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 32
Target Start/End: Original strand, 22025573 - 22025601
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctg |
32 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22025573 |
cctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 23974807 - 23974839
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgc |
33 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
23974807 |
caacctcttgtgtaaaaaagagggtaaggctgc |
23974839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 34074667 - 34074573
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||| |||||| ||| | |||||||||| ||||| || |||||||||| |||| || |||| |||||| |||||||||||| |
|
|
| T |
34074667 |
cctcttgtgtaaaaaacacagtaaggttgcgttcaatacacca--aatggcagggccccttcccaaaccctgcgtatgggggagc--tagtgcaccggg |
34074573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 107
Target Start/End: Complemental strand, 39079826 - 39079755
Alignment:
| Q |
35 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| | ||| |||||| |||||||||| ||| |||| |
|
|
| T |
39079826 |
tacaatacaccaa-aatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 79)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 20004197 - 20004089
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20004197 |
cctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
20004098 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
20004097 |
tgccctttt |
20004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 30395833 - 30395725
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
30395833 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagt |
30395734 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
30395733 |
tgccctttt |
30395725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 35005176 - 35005284
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || |||||||| ||||||||||||||||| |
|
|
| T |
35005176 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggt |
35005275 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
35005276 |
tgccctttt |
35005284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 18944696 - 18944806
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || ||||||||||| |||||||||||||| |
|
|
| T |
18944696 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccggg |
18944795 |
T |
 |
| Q |
103 |
ttgcccttttt |
113 |
Q |
| |
|
||||||||||| |
|
|
| T |
18944796 |
ttgcccttttt |
18944806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 10668278 - 10668386
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| | ||| || |||||||||||||||||||||||||| |
|
|
| T |
10668278 |
cctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggt |
10668377 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
10668378 |
tgccctttt |
10668386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 14 - 114
Target Start/End: Complemental strand, 18742054 - 18741954
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| || |||||| |||||||||||||||||||| |||||||| |
|
|
| T |
18742054 |
aaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttttt |
18741955 |
T |
 |
| Q |
114 |
a |
114 |
Q |
| |
|
| |
|
|
| T |
18741954 |
a |
18741954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 46248058 - 46247951
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||||||| ||||||| |
|
|
| T |
46248058 |
cctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggt |
46247961 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
46247960 |
tgcccttttt |
46247951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 111
Target Start/End: Original strand, 4349699 - 4349796
Alignment:
| Q |
12 |
gtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
4349699 |
gtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 27201700 - 27201809
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||| || |||||||||||||||||||| |||| |
|
|
| T |
27201700 |
cctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggt |
27201799 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
27201800 |
tgcccttttt |
27201809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 46991854 - 46991964
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||| ||||| || |||| |||||||||||||||||| |
|
|
| T |
46991854 |
caacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccg |
46991951 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
46991952 |
ggttgcccatttt |
46991964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 35253290 - 35253184
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||| | |
|
|
| T |
35253290 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggat |
35253195 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
35253194 |
tgcccttttta |
35253184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 106
Target Start/End: Complemental strand, 23768425 - 23768325
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||| || |||||||||||||||||||| ||| | |
|
|
| T |
23768425 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggat |
23768328 |
T |
 |
| Q |
104 |
tgc |
106 |
Q |
| |
|
||| |
|
|
| T |
23768327 |
tgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 34725201 - 34725097
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| || |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
34725201 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacactaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
34725106 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
34725105 |
tgccctttt |
34725097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 16 - 113
Target Start/End: Complemental strand, 45812630 - 45812535
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
45812630 |
aaaagagggtaaggctgcatacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcctttttt |
45812535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 14617091 - 14617197
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||| |||| ||||||| ||| ||||||||||||| ||||||||| |||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14617091 |
cctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaa--atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggt |
14617188 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
| ||||||| |
|
|
| T |
14617189 |
taccctttt |
14617197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 32632661 - 32632556
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||| |||| |||||||||||||||| |||||||| ||| |
|
|
| T |
32632661 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggt |
32632565 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
| ||||||| |
|
|
| T |
32632564 |
ttccctttt |
32632556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 37 - 113
Target Start/End: Original strand, 50606487 - 50606563
Alignment:
| Q |
37 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50606487 |
caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
50606563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 1517417 - 1517309
Alignment:
| Q |
4 |
cctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||| |||||||| | ||||||||| |||||||||||||| ||||||||||||||| ||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
1517417 |
cctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccggg |
1517320 |
T |
 |
| Q |
103 |
ttgcccttttt |
113 |
Q |
| |
|
||||||||||| |
|
|
| T |
1517319 |
ttgcccttttt |
1517309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 38478385 - 38478280
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| ||||||| |||||||| | ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
38478385 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggt |
38478290 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
38478289 |
tgcccttttt |
38478280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 23796518 - 23796625
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| || |||||| ||| ||||||||||||| |||||| ||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
23796518 |
cctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggc |
23796615 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
23796616 |
tgcccttttt |
23796625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 31382318 - 31382212
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| || ||||||| |
|
|
| T |
31382318 |
cctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggt |
31382222 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
31382221 |
tgcccttttt |
31382212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 42304303 - 42304205
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||| ||| |||||||||| || ||||||||||||||||||| ||||| || |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt |
42304205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 45264508 - 45264411
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| | ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
45264508 |
caacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaa-aatggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 19414502 - 19414596
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19414502 |
aaaacaggttaaggctgcgtacaatacaccaa--atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
19414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 19932856 - 19932755
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || ||||| || | |||||||||| ||||||| |
|
|
| T |
19932856 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgcc |
19932757 |
T |
 |
| Q |
108 |
ct |
109 |
Q |
| |
|
|| |
|
|
| T |
19932756 |
ct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 17 - 113
Target Start/End: Original strand, 43768205 - 43768299
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttttt |
43768299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 5 - 112
Target Start/End: Complemental strand, 41319910 - 41319805
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||| |||||||||||| || ||||||| ||||| |
|
|
| T |
41319910 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggtt |
41319813 |
T |
 |
| Q |
105 |
gccctttt |
112 |
Q |
| |
|
|||||||| |
|
|
| T |
41319812 |
gccctttt |
41319805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 6925153 - 6925260
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| | |||||||||||||||||| | ||| || ||||||||||||||||||||||| || |
|
|
| T |
6925153 |
cctcttgtgtaaaaaatagggtaaggctgcggacaatacaccga--atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagt |
6925250 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||| ||||| |
|
|
| T |
6925251 |
tgcctttttt |
6925260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 47214574 - 47214669
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||| | || |||||||| |
|
|
| T |
47214574 |
aaaacagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattacccttttt |
47214669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 9939511 - 9939628
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc-ttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||| ||| ||||| ||||||| ||| | ||||||||||| |||||||||||||| ||| | ||||| || |||||||||||||||||||||| |
|
|
| T |
9939511 |
caacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcacc |
9939610 |
T |
 |
| Q |
100 |
gggttgccctttttagtg |
117 |
Q |
| |
|
||||| ||||||| |||| |
|
|
| T |
9939611 |
gggttacccttttaagtg |
9939628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 12126930 - 12126836
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||||||||||||| ||||| ||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
12126930 |
aaaacagggtaaggctgcgtacaatacaccaa--attgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctttt |
12126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 109
Target Start/End: Original strand, 22324946 - 22325049
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |||| ||||| || |||||||||||||||||||||| || |
|
|
| T |
22324946 |
cctcttgtgtaaaa-acagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcgggagctttagtgcaccaggc |
22325043 |
T |
 |
| Q |
104 |
tgccct |
109 |
Q |
| |
|
|||||| |
|
|
| T |
22325044 |
tgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 35019280 - 35019389
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||||||| |||||||||||| |||||||||| || |||||| |||||||||||||||| |
|
|
| T |
35019280 |
caacctcttgtataaaaatcagtataaggctgcatacaatacaccaat--tggtgggacccc-tcccagaccctgcgtatgcgagagctttagtgcaccg |
35019376 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|| |||| ||||| |
|
|
| T |
35019377 |
ggctgccattttt |
35019389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 109
Target Start/End: Complemental strand, 15511256 - 15511150
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgc--atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||| ||||| || |||| | ||||||||||||||||| |
|
|
| T |
15511256 |
cctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaa-aatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgg |
15511158 |
T |
 |
| Q |
102 |
gttgccct |
109 |
Q |
| |
|
| |||||| |
|
|
| T |
15511157 |
gctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 35117873 - 35117765
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcat-atgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||| |||||||||||||| ||||| || | |||| ||||||||||||||||||| |
|
|
| T |
35117873 |
cctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccggg |
35117774 |
T |
 |
| Q |
103 |
ttgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
35117773 |
cttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 30 - 113
Target Start/End: Original strand, 45402175 - 45402256
Alignment:
| Q |
30 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45402175 |
ctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccgtttt |
45402256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 39215067 - 39214961
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||| |||| ||||||||| |||||||||| |||| || |||| || ||||||||||||||| |
|
|
| T |
39215067 |
caacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaa-aatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccg |
39214969 |
T |
 |
| Q |
101 |
ggttgccc |
108 |
Q |
| |
|
|| ||||| |
|
|
| T |
39214968 |
ggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 19701623 - 19701731
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||||||||| ||||||||| ||||||||| ||||| || |||||||||||||||||||||| || |
|
|
| T |
19701623 |
cctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaa-aatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccaggc |
19701721 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
| |||||||| |
|
|
| T |
19701722 |
tacccttttt |
19701731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 112
Target Start/End: Original strand, 27474335 - 27474439
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||||| ||||| || ||||| |||||||||| | |||||||||||||||||| ||||| || |||||||||||||||||||||||| || |
|
|
| T |
27474335 |
ctcttgtgtaaaaa-cagggcaaagctgcgtacaatacactga--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggatt |
27474431 |
T |
 |
| Q |
105 |
gccctttt |
112 |
Q |
| |
|
|||||||| |
|
|
| T |
27474432 |
gccctttt |
27474439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 8197096 - 8197203
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||| | |||| |||||||| ||||| |||||||||| | ||||| || |||| |||||||||||| ||||||| |
|
|
| T |
8197096 |
cctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaa--atggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggt |
8197193 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
8197194 |
tgcccttttt |
8197203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 25468371 - 25468285
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagct |
89 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||||||||||| |||||| ||||| |||||||||||| || |||||||||||| |
|
|
| T |
25468371 |
caacctcttgtgtaaaaatcagggtaaggttgcgtacaatacacca--aatggttggacctcttcccagaccctgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 18724650 - 18724565
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
18724650 |
cctcttgtgtaaaaaacagggtaaggctgtgtacaatacacca--aatcttgggaccccttcccggaccctacatatgcgggagcttt |
18724565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 27136760 - 27136661
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| ||||||||||||| |||||||||||||||||| ||| | | |||||||||||| ||||||||| |
|
|
| T |
27136760 |
caacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaa-aatggtgggaccccttcctagatcatgtgtatgcgggagctccagtgcaccg |
27136662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 11596563 - 11596650
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||| ||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
11596563 |
caacctcttgtgtaaaaa-cagggtaaggctgcgtataatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 7 - 112
Target Start/End: Complemental strand, 20999952 - 20999849
Alignment:
| Q |
7 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
106 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||| |||| |||| |||||||| |||| || || |||||||||||||||||||||| ||| |
|
|
| T |
20999952 |
cttgtgtaaaaaacaaggcaaggctgcgtacaatacacca--aatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgc |
20999855 |
T |
 |
| Q |
107 |
cctttt |
112 |
Q |
| |
|
|||||| |
|
|
| T |
20999854 |
cctttt |
20999849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 31442485 - 31442396
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||||||||||| ||| | | |||| ||||||||| |||||||||||| |
|
|
| T |
31442485 |
aaaaaacagggtaaggatgcgtacaatacaccaa-aatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 112
Target Start/End: Complemental strand, 6983907 - 6983810
Alignment:
| Q |
13 |
taaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||||||| || ||||| || || || |||||||| |||||||||| ||||||||| |
|
|
| T |
6983907 |
taaaaaacagggtaagtatgcgtacaatacaccaa--atggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctttt |
6983810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 43207545 - 43207640
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
||||||||| ||| |||||||||||||| | |||||||||||||||| | |||||||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
43207545 |
caacctcttatgtgaaaaacagggtaagacggcatacaatacaccaa-attggtgggacctcttcccagaccctatgtatgcgagagctttagtgca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 6 - 113
Target Start/End: Original strand, 50811994 - 50812100
Alignment:
| Q |
6 |
tcttgtgtaaaa-aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||||||||||||| |||||| |||||||||||| ||| || ||||||||||||||| ||||| ||| | |
|
|
| T |
50811994 |
tcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaa-aatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggct |
50812091 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
50812092 |
gcccttttt |
50812100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 114
Target Start/End: Original strand, 6358185 - 6358283
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||| |||||||| ||||| ||||| ||||||| ||||||||||||||||||||||||| || ||||| ||| |||||||| | ||| ||||||||||| |
|
|
| T |
6358185 |
aaaatcagggtaaagctgcgtacaaaacaccaa-aatggtgggaccccttcccagaccctgcgtatgcaggatctttagtgatcggggctgcccttttta |
6358283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 66
Target Start/End: Complemental strand, 17470451 - 17470390
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||| |||| |
|
|
| T |
17470451 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-aatagtgggacccgttcc |
17470390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 44485217 - 44485119
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||| |||||||||||| |||||| |||||||||||| || || | |||||||||||||| |||||||| |
|
|
| T |
44485217 |
caaccacttgtgtaaaagacatggtaaggctgcgtacaatacacca--aatggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccg |
44485121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 101
Target Start/End: Complemental strand, 2435892 - 2435796
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
|||| ||||| ||||| |||||||| |||| ||||||||||||| |||||||||||||||| || |||| | ||||||||||||||||||||||| |
|
|
| T |
2435892 |
cctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaa-aatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 49 - 106
Target Start/End: Complemental strand, 4587625 - 4587568
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
106 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||||||||||| ||||||||||||||| |
|
|
| T |
4587625 |
aatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 51 - 112
Target Start/End: Complemental strand, 33594191 - 33594130
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||| ||| | ||||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttt |
33594130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 19656211 - 19656104
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||| |||||| |||||| ||| ||||| |||||||| |||||||| ||||||||| |
|
|
| T |
19656211 |
cctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaa-aatggtaggaccctttcttggaccctgcatatgcaagagctttaatgcaccgggc |
19656113 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
19656112 |
tgccctttt |
19656104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 15505632 - 15505710
Alignment:
| Q |
19 |
acagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||||||||||||||| |||| || |||||||||||||| |||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg |
15505710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 20169194 - 20169084
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||| | |||||| ||| |||||||| ||||| |||||||| ||||||| ||||| ||||||||||||||||| ||| || || |
|
|
| T |
20169194 |
cctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatc--ggtgggactccttcccggaccctgcatatgcgggagcttttgtgtccctggc |
20169097 |
T |
 |
| Q |
104 |
tgccctttttagt |
116 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
20169096 |
tgccctttatagt |
20169084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 23 - 99
Target Start/End: Original strand, 7074588 - 7074663
Alignment:
| Q |
23 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| |||||||| ||| | |||||| |||||| |||||||||||||||||| |
|
|
| T |
7074588 |
ggtatggctgcgtacaatacaccaa-aattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc |
7074663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 30555211 - 30555275
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||| | ||||| || |||||| |||||||||||||||||| || ||||||| |
|
|
| T |
30555211 |
aatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgaccttttt |
30555275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 34679327 - 34679217
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac----cccgcatatgcgggagctttagtgc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| ||||| || |||||||| |||| | |||||| || || ||||||||||||||||| | |
|
|
| T |
34679327 |
caacctcttgtgtaaaaaacagggtaagactgcgtactatacatca--aatggtggagccccgttccagacccggcctgcgtatgcgggagctttagtac |
34679230 |
T |
 |
| Q |
97 |
accgggttgccct |
109 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
34679229 |
accgggctgccct |
34679217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 113
Target Start/End: Original strand, 46859129 - 46859227
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||||||||| | || ||| || || |||| ||||| |||||||||||||| | |||||||| |
|
|
| T |
46859129 |
aaaaaacagggtaagactgcgtacaatacaccaa-aatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccgggcttcccttttt |
46859227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 24564394 - 24564440
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||| |||||| |
|
|
| T |
24564394 |
caacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaa |
24564440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 4430129 - 4430088
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4430129 |
tcttgtgtaaaaaacagggtaagactgcgtacaatacaccaa |
4430088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 56 - 113
Target Start/End: Original strand, 16120819 - 16120876
Alignment:
| Q |
56 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||| |||||| || |||||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttttt |
16120876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 112
Target Start/End: Complemental strand, 19974169 - 19974073
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||| |||| |||| ||| ||||||||||||| |||| |||||||| ||||| ||| | ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19974169 |
aaaaatagggcaaggttgcgtacaatacaccaa-aatgatgggacccattcccggactctatgtatgcgggagctttagtgcacggggctgccctttt |
19974073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 22327149 - 22327204
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || |||||| ||||||||| |
|
|
| T |
22327149 |
caacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaa-aatggtggg |
22327204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 1693222 - 1693273
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcacc |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||| ||||||||||| |
|
|
| T |
1693222 |
aatggtgggaccccttcccagacccggcagatgcaggagcttttagtgcacc |
1693273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 75 - 114
Target Start/End: Complemental strand, 21773675 - 21773636
Alignment:
| Q |
75 |
gcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
21773675 |
gcatatgtgggagctttggtgcaccgggttgcccttttta |
21773636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 34149065 - 34148969
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||||||| |||| ||||||||| ||| ||||| | |||| ||||||| |||||||||| ||||| |||||||| ||||| ||||||| |||| |
|
|
| T |
34149065 |
cctcttgtgtagaaaatagggtaaggttgcgtacaaaagacca--aatggtgagaccccttcctggaccctgcatatgcaggagcgctagtgcaacggg |
34148969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 108
Target Start/End: Complemental strand, 28894611 - 28894561
Alignment:
| Q |
58 |
accccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
||||||||| |||||| ||||||||| ||||||||||||||| || ||||| |
|
|
| T |
28894611 |
accccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc |
28894561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 62
Target Start/End: Original strand, 33223037 - 33223093
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
62 |
Q |
| |
|
||||||||||||||| ||||| |||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
33223037 |
cctcttgtgtaaaaa-cagggaaaggttgcgtacaatacaccaa-aatggtgggacccc |
33223093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 15 - 67
Target Start/End: Complemental strand, 21910743 - 21910693
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
67 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
21910743 |
aaaaatagggtaaggttgcgtacaatacacca--aatggtgggaccccttccc |
21910693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 69 - 114
Target Start/End: Original strand, 24564450 - 24564495
Alignment:
| Q |
69 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||| || ||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
24564450 |
gaccctgcctatgcaggagcgttagtgcaccgggttgcccttttta |
24564495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 23371207 - 23371271
Alignment:
| Q |
35 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| |||||| || |||| || ||||||||||||||||| |
|
|
| T |
23371207 |
tacaatacaccaa--atgctgggaccccttcc-agaccctgcgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 41440664 - 41440600
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||| ||||||||| |||| | | |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
41440664 |
aatggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttttt |
41440600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 114
Target Start/End: Complemental strand, 50760273 - 50760237
Alignment:
| Q |
78 |
tatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
50760273 |
tatgcgggagctttaatgcaccgggctgcccttttta |
50760237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 50760331 - 50760287
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
48 |
Q |
| |
|
||||||||||| ||||| |||||||||||| || ||||||||||| |
|
|
| T |
50760331 |
cctcttgtgtataaaactgggtaaggctgcgtataatacaccaat |
50760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 52)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 29355962 - 29355852
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
29355962 |
cctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
29355863 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
29355862 |
tgcccttttta |
29355852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 12222022 - 12221913
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| || ||||||||||| |||||||||||||| |
|
|
| T |
12222022 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccggg |
12221923 |
T |
 |
| Q |
103 |
ttgccctttt |
112 |
Q |
| |
|
|||||||||| |
|
|
| T |
12221922 |
ttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 2166520 - 2166408
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||| ||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
2166520 |
caacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccg |
2166421 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2166420 |
ggttgcccttttt |
2166408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 2178153 - 2178041
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||| ||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
2178153 |
caacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccg |
2178054 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2178053 |
ggttgcccttttt |
2178041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 38 - 113
Target Start/End: Original strand, 12892071 - 12892146
Alignment:
| Q |
38 |
aatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12892071 |
aatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
12892146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 1347004 - 1347099
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1347004 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
1347099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 1354860 - 1354756
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
1354860 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
1354765 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
1354764 |
tgccctttt |
1354756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 9161153 - 9161261
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| ||||||||||||||||||||| | ||||| || ||||||| |||||||||||||| ||| |
|
|
| T |
9161153 |
cctcttgtgtaaaaa-cagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggt |
9161251 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
9161252 |
tgcccttttt |
9161261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 26097190 - 26097296
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26097190 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atgaagggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
26097285 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
26097286 |
tgcccttttta |
26097296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 25557755 - 25557861
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| ||| || |||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
25557755 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
25557850 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
25557851 |
tgcccttttta |
25557861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 30 - 112
Target Start/End: Original strand, 12885967 - 12886049
Alignment:
| Q |
30 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttt |
12886049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 37 - 107
Target Start/End: Complemental strand, 14975164 - 14975094
Alignment:
| Q |
37 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14975164 |
caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 7947480 - 7947371
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| || |||| |||||||||||||||| |
|
|
| T |
7947480 |
caacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaa-aatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcactt |
7947382 |
T |
 |
| Q |
101 |
ggttgcccttt |
111 |
Q |
| |
|
|| |||||||| |
|
|
| T |
7947381 |
ggctgcccttt |
7947371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 79
Target Start/End: Original strand, 6024263 - 6024338
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcata |
79 |
Q |
| |
|
|||||||||||||||||| |||||| |||| |||||||||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
6024263 |
cctcttgtgtaaaaaacatggtaagactgcgtacaatacaccaataatgatgggacctcttcccggaccccgcata |
6024338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 19340858 - 19340954
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |||| ||||||||||||| ||||| || ||||||| |||||||||||| |||| |
|
|
| T |
19340858 |
cctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaa-aatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacggg |
19340954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 1941882 - 1941992
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||| || | | |||||||||| ||| |||||||| |
|
|
| T |
1941882 |
caacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc--gaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcaccg |
1941979 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1941980 |
tgttgcccttttt |
1941992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 48 - 113
Target Start/End: Original strand, 6808467 - 6808532
Alignment:
| Q |
48 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6808467 |
taatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttt |
6808532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 37 - 114
Target Start/End: Original strand, 13267788 - 13267863
Alignment:
| Q |
37 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttttta |
13267863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 18277298 - 18277191
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| |||||||||| || |||| ||||||| ||||||||||||||||| |||| | | ||||||||||||||| |||||||||| |
|
|
| T |
18277298 |
cctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaa--atggtgggaccccttcctagactctacgtatgcgggagctttactgcaccgggt |
18277201 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|| ||||||| |
|
|
| T |
18277200 |
tgtccttttt |
18277191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 36 - 113
Target Start/End: Complemental strand, 3116204 - 3116127
Alignment:
| Q |
36 |
acaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | |||| || ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
3116204 |
acaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttttt |
3116127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 9671190 - 9671082
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||| |||||| ||||||||| || |||| ||| || ||||||||||| |||| |||| |
|
|
| T |
9671190 |
cctcttgtgtaaaaaacagggtaaggctgcctactttacatcaa-aatggtaggacccctttccgaaccctgcaaatacgggagctttaatgcatcgggc |
9671092 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
9671091 |
tgcccttttt |
9671082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 24097611 - 24097714
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| |||| |||||||||||||||||| ||||| || ||||||| |||||||||| || ||| |
|
|
| T |
24097611 |
cctcttgtataaaaaacagggtaaggctgcttacaa----ccaa--atggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggt |
24097704 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
24097705 |
tgcccttttt |
24097714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 94
Target Start/End: Original strand, 32579474 - 32579543
Alignment:
| Q |
23 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
94 |
Q |
| |
|
|||||| |||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32579474 |
ggtaagcctgcgtacaataccccaa--atggtgggaccccttcccagaccctgcatatgcgggagctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 2755518 - 2755422
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatat--gcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||| ||| ||||||||| ||||||||||||| |||||||||| |||||||| | || |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
2755518 |
aaaaataggctaaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 112
Target Start/End: Complemental strand, 23930188 - 23930126
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||||||||||| | ||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23930188 |
atggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttt |
23930126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 111
Target Start/End: Complemental strand, 383834 - 383760
Alignment:
| Q |
35 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||||||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
383834 |
tacaatacaccaa--attgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt |
383760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 56 - 113
Target Start/End: Complemental strand, 20906841 - 20906784
Alignment:
| Q |
56 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
20906841 |
ggaccccttcccagaccccgcatatgcgggagctttagtgaaccaagttgctcttttt |
20906784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 47
Target Start/End: Complemental strand, 13905085 - 13905041
Alignment:
| Q |
3 |
acctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13905085 |
acctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaa |
13905041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 33138860 - 33138957
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||| |||||||||| ||||||| || |||||||||||| ||||||||||||| || || ||||| | ||||| | ||||||||||||||| |
|
|
| T |
33138860 |
caacctcttgtataaaaaacagagtaaggccgcgtacaatacacca--aatggtgggacccttttccggaccctgtgtatgcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 12889456 - 12889562
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||| | || | ||||||||||| || ||||| | || ||||||||||||||| |||| |
|
|
| T |
12889456 |
cctcttgtgttaaaaacagggcaaggctgcatacaatacaccta-aacgatgggacccctttccggaccctctgtgtgtgggagctttagtgcatcgggc |
12889554 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
12889555 |
tgcccttt |
12889562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 6 - 89
Target Start/End: Original strand, 14553543 - 14553626
Alignment:
| Q |
6 |
tcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagct |
89 |
Q |
| |
|
|||||||||||||| |||||||||||| || |||||||||| | ||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
14553543 |
tcttgtgtaaaaaatagggtaaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 17432393 - 17432483
Alignment:
| Q |
21 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||| |||| ||||| || || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
17432393 |
agggtaaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt |
17432483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 28007658 - 28007761
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||||||| |||| |||||||||||||| ||| | ||||||||| |||| ||||||||||| | |
|
|
| T |
28007658 |
cctcttgtgtaaaa--cagggtcaggctgcgtacaatacacca--aatgctgggaccccttccctaacctc-catatgcggaagctctagtgcaccggat |
28007752 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
| ||||||| |
|
|
| T |
28007753 |
taccctttt |
28007761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 64
Target Start/End: Original strand, 32068121 - 32068182
Alignment:
| Q |
2 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
64 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32068121 |
aacctcttgtgtaaaaaacaggataatgctgtttacaatacaccaa-aatggtgggacccctt |
32068182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 3815178 - 3815084
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||| | |||| | |||| ||||||||||||| |||||||||||| ||||| |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
3815178 |
ttgtgtaaaaaatatggtacgactgcgtacaatacaccaa--atggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 10734965 - 10734905
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||| ||||||||| ||||| || ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
10734965 |
tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt |
10734905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 32728264 - 32728156
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| ||||||| ||||| || |||| ||| ||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
32728264 |
caacctcttatgtaaaaaacagggtaagactgtgtacaatataccaa--atagtggt-ccctttcccagaccctacgtatgcgggaactttagtgcacca |
32728168 |
T |
 |
| Q |
101 |
ggttgccctttt |
112 |
Q |
| |
|
||||||||||| |
|
|
| T |
32728167 |
tgttgccctttt |
32728156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 109
Target Start/End: Complemental strand, 15866134 - 15866041
Alignment:
| Q |
12 |
gtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||||| |||||||||||||||||| ||||| || | ||||||| || |||||||| | |||||||| |
|
|
| T |
15866134 |
gtaaaaaacagggtaaagctgcgta--atacaccaa--atggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 93
Target Start/End: Original strand, 24734682 - 24734760
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
93 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||| || |||||||||||||||| || || || ||||| |||||||||| |
|
|
| T |
24734682 |
aaaaaacagggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag |
24734760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 42
Target Start/End: Original strand, 8409273 - 8409311
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatac |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8409273 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 11849080 - 11849145
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
67 |
Q |
| |
|
||||||||||||| ||||||||| ||| | ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
11849080 |
caacctcttgtgttaaaaacaggataaagttgcccacaatacaccaa-aatggtgggaccccttccc |
11849145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 16895778 - 16895704
Alignment:
| Q |
31 |
tgcatacaatacaccaataatggtggga-ccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| ||||| |||||| || || |||||||||||||||| |
|
|
| T |
16895778 |
tgcatacaatacactaaaaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtt |
16895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 76 - 114
Target Start/End: Original strand, 25997749 - 25997787
Alignment:
| Q |
76 |
catatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttttta |
25997787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 101
Target Start/End: Complemental strand, 16916064 - 16915996
Alignment:
| Q |
34 |
atacaatacaccaataatggtgggacc-ccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||| || |||||| ||||| |||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
16916064 |
atacaatacactaaaaatggtaggacctccttcctagaccctacatatgtgggagctttagtgcaccgg |
16915996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 24751176 - 24751066
Alignment:
| Q |
7 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcg-----ggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| || ||||||| ||||||||| | ||| || |||||| | |||||||||||||||| |
|
|
| T |
24751176 |
cttgtgtaaaaaatagggtaagactgcgtacaatacactaa-aatggtgagaccccttcacgaaccgtgcgtatgcgtatgagcagctttagtgcaccgg |
24751078 |
T |
 |
| Q |
102 |
gttgcccttttt |
113 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
24751077 |
gttgccattttt |
24751066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 113
Target Start/End: Complemental strand, 30786407 - 30786372
Alignment:
| Q |
78 |
tatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30786407 |
tatgcgggagctttagtgcaccgggttgcctttttt |
30786372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 101
Target Start/End: Original strand, 11395836 - 11395886
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||||||| || || || ||||||||||||||||| |||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 18254559 - 18254651
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| ||| ||||||||||||| ||||| | | ||| ||||| ||| |||||||||| |||||| |
|
|
| T |
18254559 |
aaaaacagggtaaagctgcatacaatac-ccaa-aatagtgggaccccttcacagactctacgtatatgggagttttggtgcaccgggctgccct |
18254651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 114
Target Start/End: Complemental strand, 33922916 - 33922854
Alignment:
| Q |
52 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||| |||||||||| ||||| || |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33922916 |
ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttttta |
33922854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 12228389 - 12228498
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||| ||||||| ||| ||| | ||| |||||||||||| || |||||||||||||||| | || | || | ||||| ||||||| || ||||| |
|
|
| T |
12228389 |
ctcttgtttaaaaaataggataaagttgcgtacaatacaccag--atagtgggaccccttcccataacctacgtaagtgggagttttagtgtactgggtt |
12228486 |
T |
 |
| Q |
105 |
gccctttttagt |
116 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12228487 |
gccctttttagt |
12228498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 45
Target Start/End: Complemental strand, 14341166 - 14341134
Alignment:
| Q |
13 |
taaaaaacagggtaaggctgcatacaatacacc |
45 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
14341166 |
taaaaaacagggtaaggctgcgtacaatacacc |
14341134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
| Q |
56 |
ggaccccttcccagaccccgcatatgcgggagcttta |
92 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
29016337 |
ggaccccttcccagaccctgcgtatgcgggagcttta |
29016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 66)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 10543728 - 10543835
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
10543728 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
10543827 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
10543828 |
tgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 14530348 - 14530455
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
14530348 |
cctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
14530447 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
14530448 |
tgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 5841062 - 5841166
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||||| ||||||||| ||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5841062 |
ttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcc |
5841161 |
T |
 |
| Q |
108 |
ctttt |
112 |
Q |
| |
|
||||| |
|
|
| T |
5841162 |
ctttt |
5841166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 8455421 - 8455315
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||| |||||||||||||||||||| |
|
|
| T |
8455421 |
cctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggt |
8455324 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
8455323 |
tgccctttt |
8455315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 14 - 113
Target Start/End: Original strand, 10546203 - 10546300
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546203 |
aaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
10546300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 24200730 - 24200622
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||| ||||| | |||| | ||||||||||||||||||| |
|
|
| T |
24200730 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggt |
24200631 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
24200630 |
tgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 9671211 - 9671315
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
9671211 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggt |
9671306 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
9671307 |
tgccctttt |
9671315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 21779364 - 21779260
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
21779364 |
cctcttgtgtaaaa--cagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
21779269 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
21779268 |
tgccctttt |
21779260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 31158546 - 31158436
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||| || ||||||||||||||||| |||| | | |
|
|
| T |
31158546 |
cctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgat |
31158447 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
|| |||||||| |
|
|
| T |
31158446 |
tgtccttttta |
31158436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 11514466 - 11514571
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
11514466 |
cctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaa--atggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggat |
11514562 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
11514563 |
tgccctttt |
11514571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 14444759 - 14444865
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| ||||||||| |||||||||||||||||| ||||| || |||||||||||||||||||||| ||| |
|
|
| T |
14444759 |
cctcttgtgtaaaaa-cagggtaaggctgtgtacgatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggt |
14444855 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
14444856 |
tgcccttttt |
14444865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 36871534 - 36871628
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36871534 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggacct-gcgtatgcgggagctttagtgcaccgggttgcccttttt |
36871628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 17668030 - 17668139
Alignment:
| Q |
2 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||| |||||||| |||||||| | |||| || ||| ||||||||||||||||||| |
|
|
| T |
17668030 |
aacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacca--aatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgg |
17668127 |
T |
 |
| Q |
102 |
gttgcccttttt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17668128 |
gttgcccttttt |
17668139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 40762339 - 40762234
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||| |||||||||| | ||||||||||||| |||||||||||| |||| ||||| || |||| ||||||||||||||||||||| |
|
|
| T |
40762339 |
cctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaa--atggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggt |
40762242 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
40762241 |
tgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 32781396 - 32781308
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
32781396 |
caacctcttgtgtaaaaaacagggtaagactgcgtacaatacacca--aatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 17623591 - 17623701
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||| |||||||| |||||||||| | || || |||| || ||||||||||||| | |
|
|
| T |
17623591 |
caacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacca--aatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactg |
17623688 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17623689 |
ggttgcccttttt |
17623701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 17 - 113
Target Start/End: Complemental strand, 25249830 - 25249736
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| |||||||| |||| || |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25249830 |
aaacagggtaaggctgcgtacaatacaccaa--atggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcccttttt |
25249736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 25079826 - 25079717
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||| ||||||||||| | |||||||||||||||||| ||||| || ||||| ||||||||||||||| |
|
|
| T |
25079826 |
caacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcacc |
25079729 |
T |
 |
| Q |
100 |
gggttgcccttt |
111 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25079728 |
gggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 17896286 - 17896398
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||| ||||| |||||||||||||||| | ||||| || |||| ||||||||||||||| | |
|
|
| T |
17896286 |
caacctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaa--atggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatc |
17896383 |
T |
 |
| Q |
100 |
gggttgcccttttta |
114 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
17896384 |
gagttgcccttttta |
17896398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 14 - 112
Target Start/End: Original strand, 44643563 - 44643659
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||| |||||||||| |||||| ||||| |||||||||||||||||||||||| || ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
44643563 |
aaaaaacagagtaaggctgcgtacaatgtaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttt |
44643659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 108
Target Start/End: Complemental strand, 4516456 - 4516354
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||||||||||| ||||||||||||||||| ||||| || |||| || |||||||||| |||||| |
|
|
| T |
4516456 |
cctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggc |
4516359 |
T |
 |
| Q |
104 |
tgccc |
108 |
Q |
| |
|
||||| |
|
|
| T |
4516358 |
tgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 23397796 - 23397899
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| | |||||||||| | ||||||||||||| |||||||||||||||| | ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
23397796 |
cctcttgtgtaaaata--gggtaaggctacgtacaatacaccaa--atggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggt |
23397891 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
23397892 |
tgcccttt |
23397899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 98
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
98 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||||||||||| |
|
|
| T |
24890451 |
aaaaaacaaggtaaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 39914414 - 39914305
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||||||| | ||||||||||||||||| ||||| || |||||||||||||||||||| | |
|
|
| T |
39914414 |
caacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccga--atggtgggaccccttcct-gaccctgcgtatgcgggagctttagtgcatc |
39914318 |
T |
 |
| Q |
100 |
gggttgccctttt |
112 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39914317 |
gggttgccctttt |
39914305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 21377178 - 21377071
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||| |||| || |||| ||||||||| |||||||| | |
|
|
| T |
21377178 |
cctcttgtgtaaaaaacagggtaaggctgggtacaatgcacca--aatggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccgagc |
21377082 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
21377081 |
tgcccttttta |
21377071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 9 - 111
Target Start/End: Original strand, 25632544 - 25632644
Alignment:
| Q |
9 |
tgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| ||||||||| ||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
25632544 |
tgtgtaaaaaacaggataaggctgcgtacaatacaccaa--atggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccc |
25632641 |
T |
 |
| Q |
109 |
ttt |
111 |
Q |
| |
|
||| |
|
|
| T |
25632642 |
ttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 40416979 - 40416871
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||||| || |||||||| || ||||| ||||||||| |||||||||||||||| |
|
|
| T |
40416979 |
caacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat--tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccg |
40416882 |
T |
 |
| Q |
101 |
ggttgcccttt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
40416881 |
ggttgcccttt |
40416871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 51 - 112
Target Start/End: Original strand, 34080176 - 34080237
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttt |
34080237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 7214565 - 7214673
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||| || ||||||| || |||||| | ||| | || |||||| ||| ||||||||||| |||| |
|
|
| T |
7214565 |
ctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggtt |
7214664 |
T |
 |
| Q |
105 |
gcccttttt |
113 |
Q |
| |
|
||| ||||| |
|
|
| T |
7214665 |
gcctttttt |
7214673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 99
Target Start/End: Original strand, 19615022 - 19615116
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||| |||||||||||||||| |||| ||||||| ||||||||| || |||||||||||| |||| || ||||| |||||||||||||||| |
|
|
| T |
19615022 |
cctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggaccccttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 112
Target Start/End: Original strand, 23488544 - 23488619
Alignment:
| Q |
37 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||||| || ||||||||||||||||||| ||||| || |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
23488544 |
caatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttt |
23488619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 50 - 109
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
109 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
| Q |
57 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 30826067 - 30826172
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||||||| ||||||| |||| ||||||||||| |||||||||||||||||||||||| | | |
|
|
| T |
30826067 |
cctcttgtgtaaaaat-agggtaaggttgcgtacaatacaccaa--atggtggaaccc-ttcccagaccctacatatgcgggagctttagtgcaccagat |
30826162 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|| ||||||| |
|
|
| T |
30826163 |
tgtccttttt |
30826172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 33795312 - 33795400
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatac-aatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
91 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
33795312 |
caacctcttgggtaaaaaacagggtaaggctgcgtacaaatacacc---tatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
33795400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 14544093 - 14544201
Alignment:
| Q |
4 |
cctcttgtgta-aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
102 |
Q |
| |
|
||||||||||| |||||||||||||| |||| | ||||| | || |||||| ||||||||||| ||||| || |||||||||||||||||||||| | |
|
|
| T |
14544093 |
cctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaag |
14544192 |
T |
 |
| Q |
103 |
ttgcccttt |
111 |
Q |
| |
|
||||||||| |
|
|
| T |
14544193 |
ttgcccttt |
14544201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 50 - 110
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
50 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 92
Target Start/End: Complemental strand, 44521477 - 44521392
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
92 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||| |||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
44521477 |
ctcttgtgtaaaaaacaaggtaaggctgcatataatacacca--aatggcgggagcccttcccagacattgcatatacgggagcttta |
44521392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 3 - 116
Target Start/End: Complemental strand, 26684727 - 26684615
Alignment:
| Q |
3 |
acctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||||||| || || ||||||||||| |||||| |||| || ||||||||||||||| |||||||| |
|
|
| T |
26684727 |
acctcttgtgtaaaaaaatatggtaaggctgcgtacaatatactaa--atggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccgg |
26684630 |
T |
 |
| Q |
102 |
gttgccctttttagt |
116 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
26684629 |
attgtcctttttagt |
26684615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 27573651 - 27573758
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
||||||||||| ||| || ||||||||||| ||||||||||||| ||||||| ||| |||||| |||| | |||| ||||||||||||||| ||||| |
|
|
| T |
27573651 |
cctcttgtgtataaa-catggtaaggctgcgtacaatacaccaa--atggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggt |
27573747 |
T |
 |
| Q |
104 |
tgcccttttta |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
27573748 |
tgcccttttta |
27573758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 101
Target Start/End: Complemental strand, 12024023 - 12023929
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||| |||| ||||| || ||| || ||||||| |||||||| |
|
|
| T |
12024023 |
cctcttgtgtaaaaa-cagggtaaggctgcgtacaatacacca--aatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 101
Target Start/End: Original strand, 17471578 - 17471675
Alignment:
| Q |
4 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
101 |
Q |
| |
|
|||||||||||||||| |||| |||| |||| ||||||| ||||| |||| || ||||||||||| ||||| || |||||||||| ||||||||||||| |
|
|
| T |
17471578 |
cctcttgtgtaaaaaaacaggataagactgcgtacaatataccaa-aatgatgagaccccttccctgaccctgcctatgcgggagttttagtgcaccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 113
Target Start/End: Original strand, 34766330 - 34766392
Alignment:
| Q |
51 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttttt |
34766392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 11 - 95
Target Start/End: Complemental strand, 99363 - 99281
Alignment:
| Q |
11 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
95 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||| ||||||| |||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
99363 |
tgtaaaaaacatggcaaggctgcgtacaatacaccaa--atggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 23145802 - 23145736
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
73 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
23145802 |
ctcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat--tggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 23557592 - 23557526
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
73 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
23557592 |
ctcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat--tggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 24860094 - 24859986
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||| ||||||||| || |||| |||||| ||||||||||||| ||||| | |||||||| | ||||| || ||||||||||||||||||||||| |
|
|
| T |
24860094 |
caacctctggtgtaaaaa-catggta-ggctgcgtacaatacaccaa--atggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
24859999 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
24859998 |
gattgcctttttt |
24859986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 60 - 113
Target Start/End: Complemental strand, 39189555 - 39189502
Alignment:
| Q |
60 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcctttttt |
39189502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 110
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
| Q |
23 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
110 |
Q |
| |
|
||||||||||| |||| ||||| || |||||||||||||||||| |||| |||||| |||||||||||||| | |||||||||||| |
|
|
| T |
13245181 |
ggtaaggctgcgtacattacactaa--atggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt |
13245096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 22371095 - 22371151
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
73 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22371095 |
aaaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
22371151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 47 - 112
Target Start/End: Original strand, 1289093 - 1289159
Alignment:
| Q |
47 |
ataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1289093 |
ataatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccctttt |
1289159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 19977819 - 19977712
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||| ||||||||| ||| ||||| ||| ||||||||||||| ||||||||| |||||||| ||| | |||||||||||||||||||||| | | |
|
|
| T |
19977819 |
cctcttttgtaaaaaataggataaggttgcgtacaatacaccaa--atggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagat |
19977722 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
| |||||||| |
|
|
| T |
19977721 |
tacccttttt |
19977712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 44449492 - 44449395
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
99 |
Q |
| |
|
|||||||||| | ||||||||| ||||||||| ||||||||||||| ||| ||||||||||||||| ||||| || | || ||||| |||| |||||| |
|
|
| T |
44449492 |
caacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaa-aatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 15296508 - 15296404
Alignment:
| Q |
8 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| ||||| ||| |||||| |||||| | ||||| || |||| || |||||| |||| || || |||| |
|
|
| T |
15296508 |
ttgtgtaaaatacagggtaaggctgcgtacaatataccaa-aatagtgggatcccttctcggaccctgcgtatgtggaagctttggtgcgccaggctgcc |
15296410 |
T |
 |
| Q |
108 |
cttttt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
15296409 |
cttttt |
15296404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 112
Target Start/End: Original strand, 22371199 - 22371248
Alignment:
| Q |
63 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
22371248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 5450312 - 5450376
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
5450312 |
caacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacacca--aagggtgggaccccttcc |
5450376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
| Q |
56 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
|||||||||||| ||||| || |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt |
8576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 108
Target Start/End: Original strand, 31525779 - 31525838
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
108 |
Q |
| |
|
|||| |||||||| || |||||||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31525779 |
aatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 25641543 - 25641638
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||| || ||||||||||||||| | || || |||||| ||||||||||| ||||| ||| ||||||| |
|
|
| T |
25641543 |
aaaacagggtaaagttgcgtacaatacaccaa--attgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtccttttt |
25641638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 49 - 103
Target Start/End: Original strand, 31523304 - 31523358
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
31523304 |
aatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt |
31523358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 107
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
| Q |
63 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
107 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 111
Target Start/End: Complemental strand, 19185837 - 19185743
Alignment:
| Q |
17 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
111 |
Q |
| |
|
||||| ||||| | ||| |||||| ||| || |||||||| ||||||||| ||||| || ||||||||||||||||| || || ||| |||||| |
|
|
| T |
19185837 |
aaacatggtaaagttgcgtacaatgcacaaaaaatggtggaaccccttcctggaccctgcgtatgcgggagctttagtacatcgagttacccttt |
19185743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 23053012 - 23052962
Alignment:
| Q |
64 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
|||||||||| || ||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
23053012 |
tcccagaccctgcgtatgcaggagcttttgtgcaccgggctgcccttttta |
23052962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 4794875 - 4794924
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
98 |
Q |
| |
|
|||| |||||||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
4794875 |
aatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac |
4794924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 29419997 - 29419947
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacaggg----taaggctgcatacaatacaccaa |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29419997 |
caacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacaccaa |
29419947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 45235879 - 45235815
Alignment:
| Q |
49 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||| |||||||||||| ||| ||||||| |||| |
|
|
| T |
45235879 |
aatggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgcccctttt |
45235815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 46858 - 46968
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
46858 |
caacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccg |
46955 |
T |
 |
| Q |
101 |
ggttgcccttttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46956 |
ggttgcccttttt |
46968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 24877 - 24770
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |||| || |||||||||||||||||||| | ||| |
|
|
| T |
24877 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggt |
24780 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
24779 |
tgcccttttt |
24770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 97
Target Start/End: Complemental strand, 46796 - 46721
Alignment:
| Q |
21 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
97 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaa-aatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca |
46721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 43699 - 43794
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc-cagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
112 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| ||||||||||||||| | | ||||| ||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
43699 |
aaaacaaggtaaggctgcgtacaatacaccaa--atggtgggacccctttctcggaccctgcatatgcgggagctctagtgcactgagttgccctttt |
43794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 59007 - 59114
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| | || |||||||||||||||||||| ||||| |
|
|
| T |
59007 |
cctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggt |
59106 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
59107 |
tgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 48737 - 48633
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
48737 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
48642 |
T |
 |
| Q |
104 |
tgccctttt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
48641 |
tgccctttt |
48633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 10837 - 10946
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||| | |
|
|
| T |
10837 |
caacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactg |
10934 |
T |
 |
| Q |
101 |
ggttgccctttt |
112 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
10935 |
ggttgctctttt |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 30609 - 30714
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
30609 |
cctcttgtgtaaaa--cagggtagggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
30704 |
T |
 |
| Q |
104 |
tgcccttttt |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
30705 |
tgcccttttt |
30714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 114
Target Start/End: Complemental strand, 13118 - 13021
Alignment:
| Q |
15 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
114 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| | |||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13118 |
aaaaacaaggtaaggctgcgtacaatacaccga--atggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttttta |
13021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 1693 - 1591
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
100 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| ||| |||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
1693 |
caacctcttgtgtaaaa--caggataaggctgcatacaatacaccaa--atgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacca |
1598 |
T |
 |
| Q |
101 |
ggttgcc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
1597 |
ggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 24220 - 24131
Alignment:
| Q |
22 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttttt |
24131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 5 - 111
Target Start/End: Complemental strand, 72971 - 72867
Alignment:
| Q |
5 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| ||||| | |||||||||| || || || |||||||||||||||||||||| |||| |
|
|
| T |
72971 |
ctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaa--atggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggtt |
72874 |
T |
 |
| Q |
105 |
gcccttt |
111 |
Q |
| |
|
||||||| |
|
|
| T |
72873 |
gcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 11161 - 11264
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| | || ||||||||| ||||||||||||| |||||||||| ||||||| ||||| ||||||||||||||| ||||||||| ||| |
|
|
| T |
11161 |
cctcttgtgtaaaacaaag--taaggctgcttacaatacaccaa--atggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggt |
11256 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
11257 |
tgcccttt |
11264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 109
Target Start/End: Complemental strand, 10153 - 10052
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||| ||||| |||| ||||||||||||| || ||||||||||||||| ||||| |||||||| |||||| |||||||||||| |
|
|
| T |
10153 |
cctcttgtgtaaaa--cagagtaagactgcgtacaatacaccaa--atagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggt |
10058 |
T |
 |
| Q |
104 |
tgccct |
109 |
Q |
| |
|
|||||| |
|
|
| T |
10057 |
tgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 109
Target Start/End: Complemental strand, 20481 - 20380
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| ||| ||||| |||| ||||||||||||| || ||||||||||||||| ||||| |||||||| |||||| |||||||||||| |
|
|
| T |
20481 |
cctcttgtgtaaaa--cagagtaagactgcgtacaatacaccaa--atagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggt |
20386 |
T |
 |
| Q |
104 |
tgccct |
109 |
Q |
| |
|
|||||| |
|
|
| T |
20385 |
tgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 4184 - 4257
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa-tggtgggaccccttcccagaccc |
73 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4184 |
caacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataattggtgggaccccttcccggaccc |
4257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 111
Target Start/End: Original strand, 3574 - 3679
Alignment:
| Q |
4 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
103 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||| | ||| |||||||||||||| |||| || ||||||| ||||||||||||||| || |
|
|
| T |
3574 |
cctcttgtgtaaaatataaggtaaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagt |
3671 |
T |
 |
| Q |
104 |
tgcccttt |
111 |
Q |
| |
|
| |||||| |
|
|
| T |
3672 |
ttcccttt |
3679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 23626 - 23695
Alignment:
| Q |
1 |
caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
72 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||| | || |||||||||||||||||||||||| |
|
|
| T |
23626 |
caacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagca--aatggtgggaccccttcccagacc |
23695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 35110 - 35062
Alignment:
| Q |
16 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
66 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
35110 |
aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccctttcc |
35062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 61
Target Start/End: Original strand, 32958 - 33016
Alignment:
| Q |
2 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccc |
61 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||| |||||||||||||| | ||||||||||| |
|
|
| T |
32958 |
aacctcttctgtaaaaaacagagtaagactgtatacaatacaccaa-attggtgggaccc |
33016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 226500 - 226456
Alignment:
| Q |
14 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggacc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
226500 |
aaaaaacagggtaaggctgcatacaatacatca--aatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 113
Target Start/End: Original strand, 24696 - 24785
Alignment:
| Q |
22 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
113 |
Q |
| |
|
||||||| |||| || |||||||||| || |||| |||||| |||||||| || ||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaa--atagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgcccttttt |
24785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University