View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_high_7 (Length: 338)
Name: NF2794_high_7
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_high_7 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 6 - 184
Target Start/End: Original strand, 10507138 - 10507317
Alignment:
| Q |
6 |
agagagatgaagaggtttcaagttgttgttcacaatacacaatattttttatgtcgtacttgaaatttcacattaattgatgtgcttaatagttaggaag |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
10507138 |
agagaaatgaagaggtttcaagttgttgttcacaatacacaatatttttgatgttgtacttgaagtttcacattaat---tgtgcttaatagttaggaag |
10507234 |
T |
|
| Q |
106 |
ctatttctttgtcaagtcacacagacccaca----ctatgtaggaaggatatagaaaatactttattttttcttacagaatgc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10507235 |
ctatttctttgtcaagtcacacagacccacacatcctatgtaggaaggatatagaaaatactttattttttcttacagaatgc |
10507317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 209 - 338
Target Start/End: Original strand, 10507427 - 10507556
Alignment:
| Q |
209 |
ctattttaatttttctacaaaccgaagcatactgaagctctatacttttatcatgtcacatacgaggtgttccctggacaatcnnnnnnnnggtggtggc |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
10507427 |
ctattttaatttttctacgaaccgaagcatacttaagctctatacatttatcatgtcacatacgaggtggtctctggacaatc-tttttttggtggtggc |
10507525 |
T |
|
| Q |
309 |
cgaggtttgaa-tccagaccttgcatatatt |
338 |
Q |
| |
|
||| ||||||| |||||||||||||||||| |
|
|
| T |
10507526 |
cgatgtttgaaccccagaccttgcatatatt |
10507556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 304 - 338
Target Start/End: Complemental strand, 10405121 - 10405087
Alignment:
| Q |
304 |
gtggccgaggtttgaatccagaccttgcatatatt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10405121 |
gtggccgaggtttgaatccagaccttgcatatatt |
10405087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 301 - 338
Target Start/End: Complemental strand, 17704084 - 17704046
Alignment:
| Q |
301 |
gtggtggccgaggtttgaatc-cagaccttgcatatatt |
338 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17704084 |
gtggtggccgaggtttgaatcacagaccttgcatatatt |
17704046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 302 - 338
Target Start/End: Original strand, 44084263 - 44084299
Alignment:
| Q |
302 |
tggtggccgaggtttgaatccagaccttgcatatatt |
338 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
44084263 |
tggtggccgaggtttgaacccggaccttgcatatatt |
44084299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 304 - 338
Target Start/End: Complemental strand, 56205014 - 56204980
Alignment:
| Q |
304 |
gtggccgaggtttgaatccagaccttgcatatatt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56205014 |
gtggccgaggtttgaatccggaccttgcatatatt |
56204980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University