View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_low_13 (Length: 303)
Name: NF2794_low_13
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 28856950 - 28857125
Alignment:
| Q |
18 |
acctgaagcgcaaagaatacaggctcaggaagagaatagcggcgagctaaacacagagaagctgaaccacggagcgcgaatgatataggtc-aagggttt |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28856950 |
acctgaagcgcaaagaatacgggctcaggaagagaatagcggcgagctgaacacagagaagctgaaccacggagcgcgaatgatataggtcaaagggttt |
28857049 |
T |
 |
| Q |
117 |
ttgctgtgggaaagaagccacaaaatcaaattaattaatatatatgggcactaaagtaattaatgaaaatatattt |
192 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28857050 |
ttgctgtgggaaagaacccacaaaatcaaattaattaatatatatgggcactaaagtaattaatgaaaatatattt |
28857125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University