View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2794_low_15 (Length: 273)

Name: NF2794_low_15
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2794_low_15
NF2794_low_15
[»] chr4 (1 HSPs)
chr4 (190-254)||(20272495-20272559)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 190 - 254
Target Start/End: Complemental strand, 20272559 - 20272495
Alignment:
190 tgaaggggtgcctgcaaaagatattgtgaagcccaaagtaaagagatgcgctaggaggtagtagc 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20272559 tgaaggggtgcctgcaaaagatattgtgaagcccaaagtaaagagatgcgctaggaggtagtagc 20272495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University