View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_low_16 (Length: 263)
Name: NF2794_low_16
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 25716952 - 25717196
Alignment:
| Q |
1 |
acacaccttcgatcagaagtgtcaatgctacttggaattgggttgagcggtgaattactcttaccgtgactttagagctctccaatgatgaattttaaaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||| || |
|
|
| T |
25716952 |
acacaccttcaatcagaagtgtcaatactactgggaattaggttgagcggtgaattactcttaccgtgactttggagctccccaatggtgaattttagaa |
25717051 |
T |
|
| Q |
101 |
gctcaaatgtgtagctcctgacccaccatgattttggtgttttcc-aaacacacaccaagtatgattgtcttattgaggattgttgttgatgagtcaatt |
199 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25717052 |
gctcaaatgtgtagcttctgacccacc---attttggtgttttccaaaacacacaccaagtatgattgtcttattgaggattgttgttgatgagtcaatt |
25717148 |
T |
|
| Q |
200 |
gggattgttgtttttgttt-tatttcaaggtcgaatttgttcgttctt |
246 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
25717149 |
gggattgttgtttttgtttgtatttctaggtcgaatttgttctttctt |
25717196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University