View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_low_24 (Length: 236)
Name: NF2794_low_24
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3684356 - 3684135
Alignment:
| Q |
1 |
atttccctaagttagatcatgaacatatcatattctaactctcgatcctttcgaccataactaccgatgaaatcttaaacgaaattgaggacatatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684356 |
atttccctaagttagatcatgaacatatcatattctaactctcgatcctttcgaccataactaccgatgaaatcttaaacgaaattgaggacatatccaa |
3684257 |
T |
 |
| Q |
101 |
tttaaactactgaacttgagggatcaagagttaggactcgagagggaagtgagcatcctgcgggacctatagaacaacctttcattattatcagataaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3684256 |
tttaaactactgaacttgagggatcaagagtcaggactcgagagggaagtgagcatcttgagggacctatagaacaacctttcattattattagataaaa |
3684157 |
T |
 |
| Q |
201 |
agacaact-aattgattcattt |
221 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
3684156 |
agacaactaaattgattcattt |
3684135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 3702950 - 3702904
Alignment:
| Q |
175 |
caacctttcattattatcagataaaaagacaactaattgattcattt |
221 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
3702950 |
caacctttcattattattagataaaaaaacaactaactgattcattt |
3702904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University