View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_low_26 (Length: 227)
Name: NF2794_low_26
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_low_26 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 25716396 - 25716622
Alignment:
| Q |
1 |
gaggtgagttttgagtctatagttaggttttgactttattctttcaaaattgaatcattttttaattgacatttagtggttctaggttgtttggaaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
25716396 |
gaggtgagttttgagtctatagttaggttttgactttattctttcaaaattgaatcattttttaattgacgtttagtggttcttggttgtttggaaaagt |
25716495 |
T |
 |
| Q |
101 |
tcaaatttgggttctgtcttgttttgttnnnnnnnnnnnnnngtgcaatttgtgtttgttgtgtagtgctcttataaagtgttaactaaaaagcatatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25716496 |
tcaaatttgggttctgtcttgttttgtttaaaaggaaaaaaagtgcaatttgtgtttgttgtgtagtgctcttataaagtgttaactaaaaagcaaatgg |
25716595 |
T |
 |
| Q |
201 |
tatggcaccacgttaacgataatcttt |
227 |
Q |
| |
|
| ||||||||||||| ||||||||||| |
|
|
| T |
25716596 |
tgtggcaccacgttatcgataatcttt |
25716622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University