View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2794_low_27 (Length: 205)
Name: NF2794_low_27
Description: NF2794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2794_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 46549494 - 46549669
Alignment:
| Q |
14 |
cagagaaggtaagcatatagttgcaagacattctttcaggnnnnnnnnntatagttgcaacataccatctatgttggcaaaacatcaattgactacatag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46549494 |
cagagaaggtaagcatatagttgcaagacattctttcaggaaaaaaaaatatagttgcaacataccatctattttggcaaaacatcaattgactacatag |
46549593 |
T |
|
| Q |
114 |
aagttgtaagcatttttgttgtatgttaaagaatcgagtgttgctatctctttaattagtactagagagtttgaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
46549594 |
aagttgtaagcatttttgttgtatgttaaagaatcgagtgttactatctatttaattagtactagagagtttgaag |
46549669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University