View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2795_high_11 (Length: 257)
Name: NF2795_high_11
Description: NF2795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2795_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 85 - 240
Target Start/End: Complemental strand, 45526567 - 45526412
Alignment:
| Q |
85 |
ttgtttatttgtttgtgtcctgcaaatgcgtatataagtaaaataagtataattaagataagactcaatattagttgagcattgtaaaatgacaaaagtc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45526567 |
ttgtttatttgtttgtgtcctgcaaatgcgtatataagtaaaataagtataattaagataagactcaatattagttgagcattgtaaaatgacaaaagtc |
45526468 |
T |
|
| Q |
185 |
cttaattcatattggcatctaatatctttgagatctcaacagtttatgcgttgtaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45526467 |
cttaattcatattggcatctaatatctttgagatctcaacagtttatgcattgtaa |
45526412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University