View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2795_low_22 (Length: 217)
Name: NF2795_low_22
Description: NF2795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2795_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 4072271 - 4072419
Alignment:
| Q |
1 |
aatgtaccttttctcattgccttcttaaaagtcttctcttgtatcaacaactttgcatgcttctcattcaacttgtggcaccttctattattgtctaaac |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4072271 |
aatgtactttttctcattgccttcttaaaagactcctcttgtatcaacaactctgcatgcttctcattcaacttgtggcaccttctattattgtctaaac |
4072370 |
T |
|
| Q |
101 |
catgttgtcgaaaccttataaacaaccaattaggatgaggatgaacacc |
149 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4072371 |
tatgttttcaaaaccctataaacaaccaattaggatgaggatgaacacc |
4072419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University