View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2796_high_5 (Length: 259)
Name: NF2796_high_5
Description: NF2796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2796_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 5 - 244
Target Start/End: Complemental strand, 20423892 - 20423653
Alignment:
| Q |
5 |
tcgaaaaatatgtaaatgatggttgttctaagatagagttatctttaagtttagttacttggttggtcttatagggagtgtatacaatataaaagtatgg |
104 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20423892 |
tcgagaaatatgtaaatgatggtttttctaagatagagttatctttaagtttagttacttggttggtcttctagggagtgtatacaatataaaagtatgg |
20423793 |
T |
|
| Q |
105 |
agactttaatccaaataacaaatagctgaacatgtatttgtttactaaatacatattgtagcatcatatgataggatagaagttatgtcttaaaggagta |
204 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
20423792 |
agactttaatccaaataacaaacaactgaatatgtatttgtttactaaatacatattgtagcatcatatgataggctagaagttatatcttaaaggagta |
20423693 |
T |
|
| Q |
205 |
ggttactgcacattgaaattgtttcacagtcaatatatat |
244 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20423692 |
ggttactgtacattgaaattgtttcacagtcaatatatat |
20423653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University