View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2796_low_10 (Length: 238)
Name: NF2796_low_10
Description: NF2796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2796_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 35287834 - 35287626
Alignment:
| Q |
17 |
aaaagagtggtgatgatgggttatggggttttgcaatacgagaagcagaaactgctgcgattctcagagacattttttcttgttgggttaaggattgaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35287834 |
aaaagagtggtgatgatgggttatggggttttgcaatacgagaagcagaaactgctgcgattctcagagacattttttcttgttgggttaaggatcgaag |
35287735 |
T |
 |
| Q |
117 |
aagtttgttgttggggatggaaggtttgtgtgtaaagaaactaaactagcgtgttcgcgcttcattcttaaccgcaactgttactgatacgtggccattt |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35287734 |
aagtttgttgttggagatggaaggtttgtgtgtaaagaaactaaactagcgtgttcgcgcttcattcttaaccgcaactgttactaatacgtggccattt |
35287635 |
T |
 |
| Q |
217 |
tggggtcac |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
35287634 |
tggggtcac |
35287626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University