View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2796_low_13 (Length: 236)
Name: NF2796_low_13
Description: NF2796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2796_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36282501 - 36282721
Alignment:
| Q |
1 |
tttagcctaaaatctatcccttcatcctctaaaaaatctatctctttgtaagaatttgggttctctcaatttttcttaaatgaaatctcaaccttcaaac |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36282501 |
tttagcctaaaatctatcc-ttcatcctctaaaaaatctatctctttgtaagaatttggattctctcaatttttcttaaatgaaatctcaaccttcaaac |
36282599 |
T |
|
| Q |
101 |
atatgagagaaaactaaagttgaattactaagaaaagtcgtaggagcattttaaccatgtagattgaaaatggagaaaagtcgacaaaattttcatgaga |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36282600 |
atatgagagaaaactaaagttaaattactaagaaaagtagtaggagcattttaaccatgtagattgaaaatggagaaaagtcgacaaaattttcatgaga |
36282699 |
T |
|
| Q |
201 |
gaattgtaatcctcttcctctt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36282700 |
gaattgtaatcctcttcctctt |
36282721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 113
Target Start/End: Original strand, 45235027 - 45235079
Alignment:
| Q |
61 |
ttctctcaatttttcttaaatgaaatctcaaccttcaaacatatgagagaaaa |
113 |
Q |
| |
|
||||||||| |||||| || ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
45235027 |
ttctctcaagttttctcaagtgaaatctcaaccatcaaacataagagagaaaa |
45235079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 102
Target Start/End: Complemental strand, 12906665 - 12906624
Alignment:
| Q |
61 |
ttctctcaatttttcttaaatgaaatctcaaccttcaaacat |
102 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
12906665 |
ttctctcaagttttcttaaatgtaatctcaaccatcaaacat |
12906624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University