View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2797_high_12 (Length: 331)
Name: NF2797_high_12
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2797_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 157 - 330
Target Start/End: Original strand, 34242217 - 34242390
Alignment:
| Q |
157 |
atagcggggtttgttactttgctcagttgtgatggaaaattgttnnnnnnnnnnnntttatgatcaaaattattgttgttcttcgaagtacacatgcaat |
256 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34242217 |
atagcagggtttgttactttgctcagttgtgatggaaaattgttaaaaagaaaaaatttatgatcaaaattattgttgttcttctaagtacacatgcaat |
34242316 |
T |
 |
| Q |
257 |
aaaattaatggttattaggtttatagttttatgattttcaaaaatcaaacccaaaattaaggcctttgcttctc |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34242317 |
aaaattaatggttattaggtttatagttttatgattttcaaaaatcaaacccaaaattaaggcctttgattctc |
34242390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 34242080 - 34242144
Alignment:
| Q |
20 |
tttttctggtttttgcttcagagttatagatgatagctagctccttctgcaatgctgattctatg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34242080 |
tttttctggtttttgcttcagagttatagatgatagctagctccttctgcaatgctgattctatg |
34242144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University