View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2797_high_14 (Length: 280)
Name: NF2797_high_14
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2797_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 277
Target Start/End: Complemental strand, 1049696 - 1049432
Alignment:
| Q |
13 |
aaaatgtcaaagaaattttgtgctaattattataagaaggttgcagggtttcatccttatgatggagacattgtgtatttacattcttatgctgatggag |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1049696 |
aaaatgtcaaagaaattttgtggtaattattataagaaggttgcagggtttcatccttatgatggagacattgtgtatttacattcttatgctgatggag |
1049597 |
T |
 |
| Q |
113 |
tttttatttgcaacttaaggagtgatacatttgaagttgttcctggttatgagaaaattgatataagccattttcagttagagatagcagatttgttgtt |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1049596 |
tttttatttgcaacttaaggactgatacatttgaagttgttcctggttatgagaaaattgatataagcccttttcagttagagatagcagatttgttgtt |
1049497 |
T |
 |
| Q |
213 |
gccttcagagtcatcatcaccatccacggaataaaagattattggaggagtcctggtgaacttag |
277 |
Q |
| |
|
|||| ||||||||||||| |||||| | |||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
1049496 |
gcctacagagtcatcatccccatccgctgaataagagattattggaggagtcctcgtgagcttag |
1049432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 28 - 216
Target Start/End: Complemental strand, 42875178 - 42874990
Alignment:
| Q |
28 |
ttttgtgctaattattataagaaggttgcagggtttcatccttatgatggagacattgtgtatttacattcttatgctgatggagtttttatttgcaact |
127 |
Q |
| |
|
||||||| |||||| || |||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||| ||||| ||||| ||| |
|
|
| T |
42875178 |
ttttgtgttaattactacaagagggttgcagggtttcatccttttgatggggacattgtgtatttacattcttatgctgaaggaatttttgtttgctact |
42875079 |
T |
 |
| Q |
128 |
taaggagtgatacatttgaagttgttcctggttatgagaaaattgatataagccattttcagttagagatagcagatttgttgttgcct |
216 |
Q |
| |
|
|| ||| | |||||| | ||||||||||||||||||| ||||||||| | |||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
42875078 |
tagggacccggaaatttgaggctgttcctggttatgagaaagctgatataagtccttttcaactagagatatcagatttattgctgcct |
42874990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 216
Target Start/End: Complemental strand, 42751405 - 42751338
Alignment:
| Q |
149 |
ttgttcctggttatgagaaaattgatataagccattttcagttagagatagcagatttgttgttgcct |
216 |
Q |
| |
|
||||||||||||||||||||| | || |||| | |||||| |||||||||||||||||| || ||||| |
|
|
| T |
42751405 |
ttgttcctggttatgagaaaactaatttaagtccttttcaattagagatagcagatttggtgctgcct |
42751338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University