View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2797_high_19 (Length: 243)

Name: NF2797_high_19
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2797_high_19
NF2797_high_19
[»] chr2 (2 HSPs)
chr2 (128-227)||(37447671-37447770)
chr2 (1-52)||(37447846-37447897)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 128 - 227
Target Start/End: Complemental strand, 37447770 - 37447671
Alignment:
128 ttggtgaggtgagggaggagagagaagtgtggtaatttcattggcacaacgcgaggtaatacagcaaattggtggttccattgaaacaaaagttggaact 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
37447770 ttggtgaggtgagggaggagagagaagtgtggtaatttcattggcacaacgcgaggtaatacaacaaattggtggttccattgaaacaaaagttggaact 37447671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 37447897 - 37447846
Alignment:
1 tgatgtcattgcagtgccttgaagagaaaatgttttgataatattcctgcat 52  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
37447897 tgatgtcattgcagtgccttgaagagaaaatcttttgataatattcctgcat 37447846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University