View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2797_high_21 (Length: 202)
Name: NF2797_high_21
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2797_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 44041203 - 44041360
Alignment:
| Q |
19 |
actggaactaaaagagtttataattgcagccacaactgtggtggctgattgtttttaaaatcttgattgtgtctattttctatccctttatgagataatt |
118 |
Q |
| |
|
||||||||||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041203 |
actggaactaaaagattt---aattgcggccacaactgtggtggctgattgtttttaaaatcttgattgtgtctattttctatccctttatgagataatt |
44041299 |
T |
 |
| Q |
119 |
actaaatagaaatgaggaatcatgattcatgatcattggaaatttgcagcataactatcatgcagaat |
186 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041300 |
actaaatagaaatgaagaa-------tcatgatcattggaaatttgcagcataactatcatgcagaat |
44041360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University