View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2797_low_30 (Length: 281)
Name: NF2797_low_30
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2797_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 6917838 - 6917571
Alignment:
| Q |
1 |
ccatttgacttttcaacaccagtggacaaattatgttaacatcatagcctctcaaccaaccataacacaggcgtggaaacagcatgcatgtgtgccaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6917838 |
ccatttgacttttcaacaccagtggacaaattatgttaacatcatagcctctcaaccaaccataacacaggcgtggaaacatcatgcatatgtgccaaga |
6917739 |
T |
 |
| Q |
101 |
acagtcatcaaatagtgcaaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917738 |
acagtcatcaaatagtgcaaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataag |
6917639 |
T |
 |
| Q |
201 |
tctgtgcatttagcattttatattgagtgtgctcaaacaacaagcaaaaggaaaatcagaacctatat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6917638 |
tctgtgcatttagcattttatattgagtgtgctcaaacaacaagcaaatggaaaatcagaacctatat |
6917571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University