View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2797_low_37 (Length: 243)
Name: NF2797_low_37
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2797_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 128 - 227
Target Start/End: Complemental strand, 37447770 - 37447671
Alignment:
| Q |
128 |
ttggtgaggtgagggaggagagagaagtgtggtaatttcattggcacaacgcgaggtaatacagcaaattggtggttccattgaaacaaaagttggaact |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37447770 |
ttggtgaggtgagggaggagagagaagtgtggtaatttcattggcacaacgcgaggtaatacaacaaattggtggttccattgaaacaaaagttggaact |
37447671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 37447897 - 37447846
Alignment:
| Q |
1 |
tgatgtcattgcagtgccttgaagagaaaatgttttgataatattcctgcat |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37447897 |
tgatgtcattgcagtgccttgaagagaaaatcttttgataatattcctgcat |
37447846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University