View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2797_low_39 (Length: 224)
Name: NF2797_low_39
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2797_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 4520485 - 4520700
Alignment:
| Q |
1 |
gagaaagttgtgcacaaatacagtttagtatgaacaccacctccccattcgatatgagttgttggacagatggggatttctgcatnnnnnnngatgcctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4520485 |
gagaaagttgtgcacaaatacagtttagtatgaacaccacctccccattcgatatgagttgttggacagatggggatttctgcatccccccggatgcctt |
4520584 |
T |
 |
| Q |
101 |
ctacgtcttgcagatgggaatattctcttaaccttcaataaaagggaacaatgactagcaaggaaggcacgaagaaaattgaagaaattaaaagtctcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4520585 |
ctacgtcttgcagatgggaatattctcttaaccttcaataaaagggaacaatgactagcaaggaaggcacgaagaaaactgaagaaattaaaagtctcct |
4520684 |
T |
 |
| Q |
201 |
tctccctttgctactc |
216 |
Q |
| |
|
||| |||||| ||||| |
|
|
| T |
4520685 |
tcttcctttggtactc |
4520700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University