View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2797_low_41 (Length: 212)

Name: NF2797_low_41
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2797_low_41
NF2797_low_41
[»] chr2 (1 HSPs)
chr2 (101-180)||(18705170-18705249)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 180
Target Start/End: Original strand, 18705170 - 18705249
Alignment:
101 caatgaaggcatgaggatgagattgaaggttagattttcataaattggagattaaagagtgagattgaagattagaaatt 180  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18705170 caatgaaggcatgaggatgagattggaggttagattttcataaattggagattaaagagtgagattgaagattagaaatt 18705249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University