View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2797_low_42 (Length: 202)

Name: NF2797_low_42
Description: NF2797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2797_low_42
NF2797_low_42
[»] chr4 (1 HSPs)
chr4 (19-186)||(44041203-44041360)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 44041203 - 44041360
Alignment:
19 actggaactaaaagagtttataattgcagccacaactgtggtggctgattgtttttaaaatcttgattgtgtctattttctatccctttatgagataatt 118  Q
    ||||||||||||||| ||   |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44041203 actggaactaaaagattt---aattgcggccacaactgtggtggctgattgtttttaaaatcttgattgtgtctattttctatccctttatgagataatt 44041299  T
119 actaaatagaaatgaggaatcatgattcatgatcattggaaatttgcagcataactatcatgcagaat 186  Q
    ||||||||||||||| |||       ||||||||||||||||||||||||||||||||||||||||||    
44041300 actaaatagaaatgaagaa-------tcatgatcattggaaatttgcagcataactatcatgcagaat 44041360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University