View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2798_high_11 (Length: 215)
Name: NF2798_high_11
Description: NF2798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2798_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 30715977 - 30716138
Alignment:
| Q |
17 |
caaaggggtatttgtgaatggattgagggaagagtttcatgattgggttctcatgcagaaacccacatctttgaacgatgcattgagattggcatttgat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30715977 |
caaaggggtatttgtgaatggattgagggaagagtttcatgattgggttctcatgcagaaacccacatctttgaacgatgcattgagattgacatttgat |
30716076 |
T |
 |
| Q |
117 |
tttgagcatgtgagaaggattagttgaaagaaggaaattgtttctacttgtgggttttgtga |
178 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30716077 |
tttgagtatgtgagaaggattagtggaaagaaggaaattgtttctacttgtgggttttgtga |
30716138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University