View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2798_high_7 (Length: 284)
Name: NF2798_high_7
Description: NF2798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2798_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 108 - 272
Target Start/End: Original strand, 23831334 - 23831498
Alignment:
| Q |
108 |
attacaaacaggttcgtcgtgtcgtttttcttaaactcctctttctttcttttttcctctcacagtttaaattcacaatcatggttaatttatgttggac |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23831334 |
attacaaacaggtttgtcgtgtcgtttttcttaaactcctctttctttcttttttcctctcacagtttaaattcacaatcatggttaatttatgttggac |
23831433 |
T |
 |
| Q |
208 |
ttgaccttatcttcnnnnnnngttatctataggaaacaaagctatgggaattaatattgtttctg |
272 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
23831434 |
ttgaccttatcttctttttttgttatctatttgaaacaaagctatgggaattaatattgtctctg |
23831498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 232 - 272
Target Start/End: Original strand, 23818313 - 23818353
Alignment:
| Q |
232 |
atctataggaaacaaagctatgggaattaatattgtttctg |
272 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23818313 |
atctataggaaacaaggctatgggaattaatattgtttctg |
23818353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 51
Target Start/End: Original strand, 23831237 - 23831277
Alignment:
| Q |
11 |
cacagaagactcgtccatattagttctctacatatcaacac |
51 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23831237 |
cacagaagactcatccatattagttctctacatatcaacac |
23831277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 232 - 270
Target Start/End: Original strand, 23823572 - 23823610
Alignment:
| Q |
232 |
atctataggaaacaaagctatgggaattaatattgtttc |
270 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
23823572 |
atctataggcaacaaagctatgggaattagtattgtttc |
23823610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University