View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2798_high_8 (Length: 282)
Name: NF2798_high_8
Description: NF2798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2798_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 15 - 261
Target Start/End: Original strand, 8940262 - 8940507
Alignment:
| Q |
15 |
attaaataaaaatattttgtacccaatagttcatttgattgaattttaagtatcacctttgtttgaaccattnnnnnnnn--gtatcacctttaatttgt |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8940262 |
attaaataaaaatattttgcacccaatagttcatttgattgaattttaagtatcacctttgtttgaaccattaaaaaaaaaagtatcacctttaatttgt |
8940361 |
T |
 |
| Q |
113 |
tggtttccatgaannnnnnnagtctaaaaactgaaaaaattagagaaattattattaataacggtgacctaattaatatgccacttttgtttttgcaagt |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8940362 |
tggtttccatgaattattttagtctaaaaactgaaaaaa---gagaaattattattaataacggtgacataattaatatgccacttttgtttttgcaagt |
8940458 |
T |
 |
| Q |
213 |
ttggatatttatgaaggtaggtgttggtgtaatggatagaaggaccact |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8940459 |
ttggatatttatgaaggtaggtgttggtgtgatggatagaaggaccact |
8940507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 189 - 260
Target Start/End: Original strand, 8927929 - 8928000
Alignment:
| Q |
189 |
tatgccacttttgtttttgcaagtttggatatttatgaaggtaggtgttggtgtaatggatagaaggaccac |
260 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8927929 |
tatggcacttttatttttgcaagtttggatatttatgaaggtaggtgttggtgtcatggatagaaggaccac |
8928000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 69
Target Start/End: Original strand, 8927828 - 8927875
Alignment:
| Q |
21 |
taaaaatattttgtacccaatagttcatttgattgaattttaagtatca |
69 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
8927828 |
taaaaatattt-gtacccattagttcttttgattgaattttatgtatca |
8927875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University