View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2798_high_9 (Length: 238)
Name: NF2798_high_9
Description: NF2798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2798_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 24 - 219
Target Start/End: Complemental strand, 39233223 - 39233028
Alignment:
| Q |
24 |
atcgatataaaattgttatttttaggtttcttaacatgtgtcattagaagacaataacaccctacgaacaaaccttatgagattgaattnnnnnnnnnnn |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39233223 |
atcgatataaaattgttatttttaggtttcttaacatgtgtcattagaacacaataacgccctacgaacaaaccttatgagattgaattaaaaaagaaaa |
39233124 |
T |
 |
| Q |
124 |
nngaggagagaagctaaacccccacggagaaagataagatgatgttgatttttaagcaaccaaagaaattggattggttgaatttcttttatctat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39233123 |
aagaggagagaagctaaacccccacggagaaagataagatgatgttgatttttaagcaaccaaagaaattggattggttgaatttcttttatctat |
39233028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University