View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2798_low_10 (Length: 257)
Name: NF2798_low_10
Description: NF2798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2798_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 21378505 - 21378738
Alignment:
| Q |
11 |
taatttatttgcacaccatcctcattaatatattttttacattaattctcttttgagtaataaaacgaggatcacacattcattctcagacaagtttctc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378505 |
taatttatttgcacaccatcctcattaatatattttttacattaattctcttttgagtaataaaacgaggatcacacattcattctcagacaagtttctc |
21378604 |
T |
|
| Q |
111 |
tagcnnnnnnnnctttccaaataaaggtgtaagattagtatgaagaaaatattgttgtgtgcacgatatatttatcaaataaaaattgaatattgagttt |
210 |
Q |
| |
|
|||| || |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21378605 |
tagctttttttttctttcaaataaaggagtaagattagtatgaagaaaatattgttgtgtgcacgatgtatttatcaaataaaaattgaatattgagttt |
21378704 |
T |
|
| Q |
211 |
gatacttga---tacttatttggactttggttag |
241 |
Q |
| |
|
||||||| | |||||||||||||||||||||| |
|
|
| T |
21378705 |
gatacttaatagtacttatttggactttggttag |
21378738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University