View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2799_high_4 (Length: 300)
Name: NF2799_high_4
Description: NF2799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2799_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 7165652 - 7165916
Alignment:
| Q |
18 |
tgttttacttctcaaccaccattatcaccaaaattttaattcacttttatccttttcgtcgtgtcacaatcgttaatactatataaagcttttgtcaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165652 |
tgttttacttctcaaccaccattatcaccaaaattttaattcacttttatcattttcgtcgtgtcacaatcgttaatactatataaagcttttgtcaaaa |
7165751 |
T |
|
| Q |
118 |
aactataactaaaaattatttatggtcaaatgtgatcaataccatctcaatctcatttacgtagatatttaaaacttagatatctttagcttgtcattaa |
217 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7165752 |
aactataactgaaaa----ttatggtcagatgtgatcaataccatctcaatctcatttacgtagatatttaaaacttagatatctatagcttgtcattaa |
7165847 |
T |
|
| Q |
218 |
cccttt-nnnnnnntagttgtgacatccatgtcatcaccatctttaccacctaggtacctattccctgt |
285 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
7165848 |
ccctttaaaaaaaatagttgtgacatccatgtcatcaccatctttgccacctaggtacctattcactgt |
7165916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University