View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2799_high_6 (Length: 262)
Name: NF2799_high_6
Description: NF2799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2799_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 252
Target Start/End: Complemental strand, 31404499 - 31404268
Alignment:
| Q |
21 |
tggtgactgaactgagaacaaggtcgagtcttggtcaatgcttctcactgcgatggcggacccgtgtaatgagaggaacctcatacaaagtttgatctca |
120 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31404499 |
tggtgacagaactgataacaaggtcgagtcttggtcaatgcttctcactgcgatggcggacccgtgtaatgagaggaacctcatacaaagtttgatctca |
31404400 |
T |
 |
| Q |
121 |
ggagttaggatcatatatgtcatcaaatttttcagatatgctttggttaatttacttctaattgttacttgatagtgcttttgatgctacttatttttac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31404399 |
ggagttaggatcatatatgtcatcaaatttttcagatttgctttggttaatttacttctaattgttacttgatagtgcttttgatgctacttatttttac |
31404300 |
T |
 |
| Q |
221 |
ttacagtcgatgtgtgatcattaggatctgtg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31404299 |
ttacagtcgatgtgtgatcattaggatctgtg |
31404268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University