View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2799_low_11 (Length: 263)
Name: NF2799_low_11
Description: NF2799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2799_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 2 - 246
Target Start/End: Complemental strand, 40033762 - 40033527
Alignment:
| Q |
2 |
catcaaatagaaatgaaattgtaccctaaattgtgcgaaagaaatttaccttgaatgaagttacccagaaaccctagaaccggtagagaaaatgaaatgg |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
40033762 |
catcaaatagaaacgaaattgtaccctaaattgtgagaaagaaatttaccttgaatgaagttactcagaaaccctaga---------gaaaatgaaatgg |
40033672 |
T |
|
| Q |
102 |
tgagagaataaacagggttacatgatttatatggtgcagcgtcgtttttctttattttgacggaattgccctttgtttttgcatgcaccgccactctctg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033671 |
tgagagaataaacagggttacatgatttatatggtgcagcgtcgtttttctttattttgacggaattgccctttgtttttgcatgcaccgccactctctg |
40033572 |
T |
|
| Q |
202 |
agccccctataatatactgccatgatttctggcttcaacacaaag |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033571 |
agccccctataatatactgccatgatttctggcttcaacacaaag |
40033527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University